Description :
From Genome Similarity Track
Location :
Scaffold_1832:22- 3630
Sequence
3608 bases(100 bases per row)
ACGCGCCTGGGTTTCTGAGATTCTCCAAGAAGCCCCAAAGGATCCCGGTGTATCTTTTGGTGGACCGAAGTAAGCGGGACGTGGTCAACCAAACACCCAC
CGACCCAACTTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAAC
AGTGCGAGGTCATTGATGCTTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGATGCCGACTTTCTGCGTTCGTAA
GCCTTACGGAAAGTGGCGTCTGGCTCACGCTTATAACAAGCTGAACAACACAACGGTGCCGGCCCAAACACCGATCCCACGAAGGGATGTGTTGTTGAGC
AACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCA
CTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTT
GCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCTATGGAGGTGCATCTAGGTCACCTCCGTCGA
GTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACG
TGGGCGTTCGGGCTGACCCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACT
ACCTTTACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGA
CGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGAGGAGACGAAGACGTTTAGCGTCGTCTGCGATGCCTCCGATTAC
GCCATCGGGTGTGCATTGCTGCAGGCCGACACGGCCGGACATGAACGAGCCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTG
TCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACACGTC
CTTGAGGACGGAAACTAACTCGCCTCACCACTTTAAAAGGATGGCGAGGTGGCTGTCCTTCTTCACGGAGTACAACTTCCGCGTCGAATACAAGCCGGGC
AAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCACGG
CGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCT
CCGCCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGAC
ATCCTCGCGGAGGCGCATGACGCGCACTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCAGTCTCTCAGTCCTTCTGGTGGACCCACATGTACA
AGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGA
CTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGTAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATG
TACCATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGCTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTG
TCTTAGGGACCGAGACCCACGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCAATGCGGACCATCCGCAG
ACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTTCGACGCAGCTTCCAGTT
GTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACGCTTCGAG
GAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGA
ATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGA
GGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCTCTAGACACGGTTAGCTCTGTCGGCAGCAACAAGCTGAAGC
ACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGG
ACGTCTTAAGCGGTACTTTGACCCGCAGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGG
CGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCCGGCGCCATACGC
CGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATC
ATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGACCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAA
GACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCG
GTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCC
GCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGG
GGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTC
ATAAGTAG