Description :
From Genome Similarity Track
Location :
Scaffold_730:22- 2593
Transcript NameFunction/comments
g16112.t1hypothetical protein

Sequence
2571 bases(100 bases per row)
ACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGC
CGGCATGTTCAGCCGCGTCTCGATACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAGAATAGC
AGGCGTAAATAGAGCGCTCCATATAAACGCGGTGAAACATGCATCACATCGCGACCAATTGCAGCCTGGTAACTTTTACGTCGAAGCCCAGCACTTCGTG
TTTCCATGACCAGCGGAATTTCCTTGGGTATATCCTGGTACAGCATTGTCTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGG
GTCAACATGGTGTGATTCCCACGACCAAGGACACGCTCCGGGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAG
TGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAGCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTT
TGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACA
GCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGCTGT
CGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGACGCCGTCTGTAGACCGGATAGCCGTTCCCATTGGTCCTTGTCGCCTCTGCAAAAGG
TTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCG
AATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCA
AGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGCGC
TTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGTCCTGAGCGTTTTGTTGATCAGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGG
CTGCAGGTCGTTGTCATGAACACATCAGGCTTGTCGAATTCTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCTCGAGGACTGCCCATAT
GAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAATGGGTATCACCACCACGGCCCCGATCAGGGTGGACCAACGTATTATCGCCTCTGTC
AAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTTCCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCTGTATTGATCGGCGCGAATTTGCTTC
TGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACT
GATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGAAGGGACATCTGGCTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCTGTGTA
GGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGGTACTGAAGAGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTA
TACAGTAGTAGATCGCGAGGCCTATCCAGATTGCCGTCCTCGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTA
TATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCTCGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTG
CTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGATCCAAGTCAGCAAAGATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACA
ATATAGATCTGCGCGAATTTAGGGTCCGTGCGCTCTCCGGTGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGC
GGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAA
AGCTTGGTTATACGCTCGTATGTGCTGTCGAAACGCTGGATCCCGGTACAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTG
TCTTCCAGACAACAGCTCATTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCACAAACAGTGGT