Description :
From Genome Similarity Track
Location :
Scaffold_250:22- 1955
Sequence
1933 bases(100 bases per row)
CACGCCACCTTGTGGAAGTGCATTGTGGGTGCGAAGATATTGGGTGAAACACATAAAAGTGATCCCACATGCACAGTTGACGTCATCGTCTGATGTCAGA
GCAATCTGTGTCTGAGTTGAGTGTTGATCGCTCGCAATCATTGAGATTCGGCGTGATTATGCACGAGAGTACTCTAGACATGTGAATGATGGTTCCTACT
TGGGGAAACCACACTGGTGACGAGATCAACGTGTCTCTACCATCTGAACTGAGTGGCTTCCGCCAATCACTTTGCAGGGAATCTCCGCGGTACTTCAAGT
TCAAGTTTCCAGCAGATCCCCTGGGTTCAACCTTAGTGTACCCAAGGTTTTATATATCAGATTCATAGGTTTTATTTCTGCATGTTTAGGTTTTACAAGT
AAAACCTCTAGGAGCCCTAGTGGTGTTTTATATGTAGTGTCAGGAACCATAAGCTCATTTTCAATTCAGTTGCAATTTTGCCAAGTTCCTCCCAAGTCTT
CCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACATTCACCGAGCAAATAGACTCGAAACTTTGCCAATGCATATTTC
ATGGCCAATAGTTCCTTGTCGTGGACTGGATAGTTCCTTTCGGCGGGCCTGAGTTGTCGTGACTGATACGATACAACTCTTTCTTTGCCCTCATCATCGT
GTTGCATCAGTGCACACCCGATGGCATAATCGCTCGCATCGCAGACTACATGGAACGGCTTCTCATGGTCTACGAGAGCTAGGACAGGAGCTTCTCTGAA
GCTCTTCTTTACTTCGGCAAACGCTGCCTGATGTTCCTCTGACCATTCCCACTCATTTTCTTTCTTCAAAAGACTCGTGAGGGGTTGCACTAACGCTGCG
TAGTTGCGCGTGTATTTGTGCAAATAGTTGGCCAAACCCAACCACTGACGTAGCTGTTTGACGTTCTGAGGAATAGGCCAATCGTCAATAGACTTGACCT
TCTCAGGATCGACCCGAACGCCATTCTTGCCAACAAAGCAACCGAGTACAGGGATCTCGGGGGCGAAGAAGATGCATTTCTTCAAGTTAGCGTACAGTTT
ATTATCACGCATAACTTGAAAGACTTGACGAAGATGTCCAAGATGAACATTGACATCTTTCTTCCCTTCCGAGGCCTTGCTGTGAACGAATATGTCGTCA
AAGTAGCTCGGTGCAAACTCTCTTAATGGACGAAGTACATTCGTGACCATTCTGTTGAAAGTTGCTGGTGCGTTCTTCAGAACTTGTGGCATCACCATCC
ACTCCCACAGCATACCACTAGGGGTGCTTACTGCTGTAAATGGTACATCACTCTCACGCATACGAATCTGATAGAATCCATCTTTCAGATCGATCGCGCT
AAAGACAGTGCTGCCAACCATTCCATCAAGGATCATATCCTTTCGTGGAACTGGAGTCTGAGCAGGTATGGTCGCATCATTCAATTTGTGGAATGCATGA
ACAATGCGCCAACCGCCTGTGGCCTTTTTAACACAAAAGGTGGGACTACAGTGCGGAGACTTGCTCTCGCGCACATGGCCAGCCTTCTGTCGCTGCGCGA
AGAACTCATCGATCGCATCGACTTGTTCCTTCGGTAGCGGCCATTGCCTTGTGATACAGTACTTTGTTCCCGGAAGTACATCTATCTCGTGACGAATGCC
TCTATCCTGCGGCAATTCGTCCGGCACTTTGTCTGGAAATATGTCAGCATATTCCTTGACAAGCCCATACACGGGGTTTATCTTTAGAGCGTCCCACGAC
TGCTTATTAAACCTTTCCTTCCGTGTCCTTTCATCTAACACTTCCGCAGTGTTGATAGCATCGCCGGCAACTTCATCGACGATCACACAAATTTGCGAAA
TTTCGCCTTTCACCAGGCTACGCTTAAGCGTCT