Description :
From Genome Similarity Track
Location :
Scaffold_550:22- 1482
Transcript NameFunction/comments
Hyaar_Emoy2814314hypothetical protein

Sequence
1460 bases(100 bases per row)
TCGGGCGGTGCGAGCGATCCGCGAGAAAGTCGAGAGCAGCGGATCGGAATCGGAGTCTATTGGATCCGAGGAATAAGTGGATCTTCGTCGTGTATGTGCA
ACAACTACACCCGACCAAGAAAAACCGAACAAGGATCATCGCACCTGGCAGAAGAACACTGTTGAAGGGGAGGGACGCGATCGTAGTGGACGATCGAAGG
CGTGCATCCATTGTGGATCTACCAGACACGATCATCGAGGAAGAGATTGACGTGCCAGAAATGTGGTCGCAAAGGACACCCCTCTGACAAATGTTTCTTC
GTGTGTGCAGCCTGCGGGGATATACACGAGTGGAAAGTGTCCCATGGAAGAATTTTTCAATTTGGTCCAAAAGTGGTACGTGCCTACGAGGCATGCTGGA
ATGTTTCACCCAAGGTGGAGGAGATGTTAAACTAGAACGCTCGTCAGGTTGGAATCTGGCACGAGCCGAGCGTTCTAGGCTTTGCATTTATGCATTTGTG
GAAGGACCAGGGAGAGATCGAGAGATTAACGATCGGATCGATCCGATCGCTGATATACATAAAGATCTTGCATTGGTCTCGTCAATATCAAGTGTAAAAA
GAGTGGATGATTACGCCCGATAGCCTGTGAGGATGGAGCTCGACCTCGCACCAGGGGAATCGCGCAGGCATTGGAAATACCACACCCCCGGAAAATGGTT
CAAGCAAGCAAAAGCGTTGGGCAAGATCAACGATGAGAAAGCCACGATGCTGTTCGATTCCGACGCTGAAGTGTCGATCCTCGATACTACCTTTGCTCGT
AAGATAGAATGTGTGATCGACGACAGTCAAACACAAGAGTGCGTCGGAATTGGAGTGAACACGTATATGACAGTGGGACGGACGAAGATTAAAATCACTT
TGGACGGATCGTTGGTTTATTGTTTCAACGTTTGGGTAGGTGATCAGGTCGGCCAAGATGTCATATTGGGTATGGATTTCCGGGGGGCACCCGTTTGGAC
TTAGCCGACAGAACATTATGTCTACCTGACGAGGTGCGTATTGGTTTGGCAGGACGGAAGCCACCGTATCGATCGACCATACGGGCGATCAACCTGAATG
ATCAACATGTGGTCATACCGGTTGGCAGATCGACAGAAGTACGTATTGGGATCGGCCCACCTCAGGCTAAGCTTTGGGTGAGGCGAGACGTGGCGTGGGT
GCCGACAATCACTAGTGGGCCCTGCCAGATCAAGTATTTGCAGCTCACGAACCTCAGCGATCGTGAAATAATTTTAAATCATGGGGCTTCGTTGGCTTTG
TGGATGACATCGGACATGATACCTAGATCACCAGGGTATGTATCGATCGGGTCACGGCGGTATAAAGAATGGCAAACGCTAGCGTTTGAAGCGACTACGA
GACGAGAGGAAGAGACGGTGGAAGAGTATGCAGGGCTGTTGGTGGATCATCCTGTGTATG