Description :
From Genome Similarity Track
Location :
Scaffold_52:22- 1305
Transcript NameFunction/comments
Hyaar_Emoy2806540reverse transcriptase putative

Sequence
1283 bases(100 bases per row)
TCCTAGCAGAGGTGGGATCATGACTCTCCAAAGCTCCGCTAGGGGCAGTGCGCGTGGCGCCTAATGTTTTCGGCCTCCAGTCGATCCATGGCTCATGGCG
CTCAAGCCAAGCCATATTAAGAATGATATCATATCTCGAGTCCAAATCAAGGACTAAACAGCGTTCGACACTATCGAAATCGAAAAACTTCACACCTAAG
TTCACAGGAACTTTGGGTGTGGTGACTAGAATTCCTGTCGCCAAGCGAACAGTGATCTTATCACCCTGTGCGCTTTTAGCGCCCCGATATAACGTGGATT
TCCTTCAAGGGAATAACGTTTGACATAATTACCAGATGATATGGAGTTGTTTAAAATCGACCAGGGTTTGTCAAAGTCCTTAACAGTCGCCTTTTCGACC
AACAAGTCTGGCTTGTATTCACGCCCCGTGTTAGAGTGCACGGGACTCCCTGGGGCTAAATTCTGCTCGCCTCTACCTCCTAGAGGCTCAACAGAACCTA
GTTCTTCTCCAGCAGGGCGCCCCGCACCTACTGGAAGTCTACGTTTTCCCGCACCGTACCAGACTTCTGGTTAGCGGCAGGAGTTCAGCCTGAAGTAGCG
TGGCGTGCCATGCGTAAAGGGCAAGCAAGTCGCAAATGCTTTGTACTTCCGCACGTAAACATCGTCAAATGTTTCGATGCTGTTCTATATCTCAAAGCTA
TGCTTCTTCGTCCGTCTCGGCGAGACCGCGGTCTATAGGCTCCAGCCTATTAAAGGAACTAAAGGAGCTCGTCGAGTTTAGGTTGTACCCATGGGTGCCA
AAACGGGCTGCCTTAAAGTTGAACTCAGTGTTCAACGCGATATCCACAGCCGCCGCAAACGAGGTAGGGTGTACCCGGAATACTTCCGTTCGAGCCACGC
CCGTACGAAGGCCCTCCATGAAGATGCTAACAAAAACCATTTCTGGTAAGGGATCAAGCTGCATGGCAGCGATTAGAGTTCTCCGTTCCTGGACATAGTC
CGATAGTACTTTCTTGCCCTGACGGGCAGATAGGAAACGAGAACGCACCCGGTATGCCTGATTAGGCGGAGCAAACACCCAGGATATTTGCTGTTTTAGC
AAATCCCGTGTGGGGAACCGACGTGCTACACGTGAGAGCCCATTCTCTGGCTCTACCACCCAGTTTTGAGATAGCCATCCCAACTCGCTGCGACTGGAGC
ATAGCAGTTCATGGCCATTTCCACCTCTCTGATCCACAGGAGAAGATTATCCCCTTCTTTTCCTTCAAATGTCTTTACAGTCA