Description :
From Genome Similarity Track
Location :
Scaffold_32:219936- 224376
Transcript NameFunction/comments
Phyra_95137Hypothetical protein

Sequence
4440 bases(100 bases per row)
CTCAGCACCGATGCCACCCAGAGCCTGCGTGCCCCGCAAGGAACAATTGGCGTTGAATTGAGAACGACACCCCCCGTTTCGCGACGCACCCAGTTTCTAC
GTGGTGCTAAGAAGCCCAAAGCCTTGACGACCATCACCAGTCCGACTACTACAACGATGCAGAATAGCAGCATGATCGCACTGTCGTCGAAAATATACGT
CGAAGCATTGAAAAGCCCGGCAGGATTGCAGTGAATGATGTCCATGATTTGGCTTTCGTCGGCGAGTCGGAACACATTGGTGATATTGGTGTCTCGATAG
AAGGTCCTTTTGTACGGACCACAGATCGTCAGCGTGGACGTAAAGCTGATGACAAGACCGCGAATGCCAGGAGTTCCGTCGCTCCAGTGGCCGCGAGTCT
TCTTTACGGCGAAGACGACTACGGTCACTACAAGTGCCAGCAACCAAACGTTGCGCATCTGAACTGCGGTCGTTCTCAAGAATGTCACGAGCCCAATGTT
GATGGTGCCTCCTACAGCAGTCCAGTACGAGTCGAGGAAAATATCCGCGAAGCTGCCGTCCAAAAGCAACGCTACCACATACCCAGTCACAGGCAGCAAA
CTAGAGTACACAATGACCTCGAATGGGATCCTGAAAACGATCGCCACGACTGACAAACACACTGAACGGGGCTGTGACTGTGGACTTCCAGCAGCCTCCT
GTCTAGCAGCTACCGACGCACCGTAGATCAGCAGAGCCAAACGAATCCACACATAGGCCTGCGCACCGCCTCGCAGCACTGAAATGATGCCGTACCAGTC
GATGACGTTGGTTTGGACGGTATCGCGCTCATAGCGGTGATCGTCTACGAAAACTGTCGTACACGTCACGACTTTTGGTTCCGACGACGAGTTGGTTTCC
AGTTCGACGCAGCGCCTTCCTCTAGTCAGAAGAGCGACTTCCAGCGCTTCGTAGTTGTAGTAAGTGGACCGCATGACTCCCGATGTTGTCGAAAACCGTT
GTGAGGATAGCAACACCACGTCCAGTTCCAAGTCCGGATACCGTTGCTTTAGAGCCTGTAGTCGTAGATCCATGTGATCCCAGAGACGGACGGCGGGGAG
TGAAGGGTCCAGCGGGTGTGGGCACTTCCAAATGCCTGGATGATTGCAGAAGCGAGGTCGTAGTGAAGAGCGTTTTGTATTACCAGCGTTGGAGCATATT
GCGAGCGACTGCGCTTTTCGGGGGATACTTACGACATGGAGCGAATGCACCCTCCATGCTGGGTTCTTGGAAGCGAATCGCACGACGTAGTGGTGGAGGC
GGTCAATCCAGTTGTGTTTGGTGGCGAAGCGCAAGGTTGAGTAGGTATTGTCTTCTCGTAGTAGTTCAGCACGCGCTGTAGTCATGAAAGCGTCAAGCAT
CGTGAATATGGTGCTGAGCCCGATCAAGGTGTCTGGATTCGTTGCTTGTTGGCCTTTGTAGAGCAAGAAGTCGGGGAACTCGGTCACGTTGAGCAGCTCC
ACAGCCCCTCGAAGACCGACAGAAATGGTGTCGTGCTGGTACGGCCACGCTCGAACGGCAGACATGGTCTGGACGCCCTTGAGTCCTACGAACGTTTCTG
ATGCGCTAACATCGTCGGTGCTATTGTCCACGCGCCAGATATGTGTGATCGGGTAGTCAACGGGCCCAAACCGGACAGCGGTGCTAGGCATGAAGGGAAC
CGGATAGTACTCCAGTAGGTTGCGCACGCCGAGTCCTGTTCGCGGGATGTCTGTGACTAGAAGTGCAAAAGATACTAAAGTGACGAGACATCGCAGTTTG
GAGAGTGCGATACACCCTGGAATATCTGGCTGTGGGAGGAGCTTCTGCCACCCTCTCGTTCTCGCGTTCGTCACCGTCCGGGCGCTGTAGCTTCTGCTTG
AGTCGACACTTGCATCGCCGTCGGGTGCTTGAGCGCGAGAGTTGGCATGGCACCATGTCGGGTGGATTGCTACCATTATTGGGGACTGAGATCCTGCGAT
CGCAACTACCGAAACGGACTTTGCTCCACGTTTAGCTCGCGTTGGCCCCCAGTGAACACCATTGCCATCATGACGAAATATGGTGTGGAAATCCAAATTT
GGTTCGAAGTTGACACGATATGCTTGATTAAACTGTTGCTAGATGGCTCGAGTAGCAAATCCAACTGTTCCCCGGCCGCTTCTCCTATCCGCATTGGAGC
AGAACGGATATTGGTACATCACGGGAGCTTGCCGAGTCAAGGAGCTCGAAATCATCACAGCTCAAGCCCGTGCGCTCCCCCATCTCGGCTTCAGGGTATG
GTAAGATAACGGCATACCATAGAAGGCCAGTGCTGTTGTCAAGCCCGGAGGCGGCTGAGCGAGCGGGTCGAATTCTGTACAAATACAGCGGGACGCCAAT
CACGCGCAGCCAAATGAAGTTCCACGGGTCGGTCATCATGGCGATGTTCATGAGCTGCAGTATCGAGTGAGATTCCGCCGTACGAGCGCACAGTCCGCCT
GCTGATTGGGCTCGCGTTGGCACTGACGGGGCTCGGTTTCTCCTGCAACAATTCCACGATGTCATCGCGAACCCAGTAGTTTTCCTCGCCTGAGACATCG
CAGACGACGGCGAGACTTTGGATAGGTTTATGGATGGATGCCGCAGCTCCGAGGAAAGTTTAGCGAGACTTGGCTGCTTTCGGAGGTCGTATTGGTATGG
GGCACAGCTTCGCAAGGCATTGAATCGGATGCTGAGTGACGAGGTCGGCCAAAGGCTTTCAGTGCCATACGGTACATTGACGGTTGAAATCAAGATCAAG
TCTCGATCCATACGCATCAAGTGGCCCATTAGTCTGGCTGTACCTGCCACTGCCGCGACGATAGCGATGCACAAAAGCAGCATGGTCATGCTGTCACCGA
ATAAATACGTGGAACCATTGAAATACCATTGTGGGCCGGACTGGACGACATCCAAGTTTTGGCCAGCGTGGGGGGATCGGATGGCCGTCACGACTTTCGA
GTTACGGAAGAAGGTGTGTTTGTACGGCCCAACTACCGTCATCGCCGACGTGAAGCTAATGACAAGTCCCCGAACGCCAGGGATTTTCTCCTCCGAGCCA
TTGCTGGGTTTCCTTGCCACGAACACCATCAAATCAACCAGCAGAGCCATCAGCCAGACTGTTCTCATTTGAGTCACTGCTGAGTTCAGGAAGGCCACAA
ACTCGAAGTTTGTCGCCCCTTCCAGCGAGGACCAGAACGAATCGAGGTAAATATCCATAAAGTTGCCATCCAAGAGCAGCGCCACTGCGTAAGCTGCAAC
CGGCAGTGGGCTGCTGTATACGATCACCTGGAACGGGATCTTGAACACTATCACGATTGCGTACATGATCCGAGAATGCCAAAACTGTCCCCCACTCTCT
GGTGCCTCTGCGGCAATAAAGGCGGCTACATAGAGCAGAACCAATCGAGCCCAAAAGTACCCCTGGGCACCTCCACGCATCATCGCGATGAAGAAATACC
AATCCACGATGTTTGTCTGGAGCAAGTTGCGTTCATAGCGGTAGTCGTCGACGAAAACCGTCGTGCATTCGCTCGTGCAGCGCCTTCCTCGAGTTAGCAT
AACGATTTCCTGCTCCTCACAGTTGAAGATGGTGTAGCGCAAGGATCCCGAAGTCATGAATGGCCGATGCGTCGCAACCAGCACAACGTCCAGCGTCAGC
GCTGGATATTGTTGCTGTAGCTCCTGGAATCGAAGATCCATGTGATCCCAGACCCTTACAGCAGGAAGTGATGCGTTTGACGGGTGCTCGCAATACCAGG
GTACAGGGTGAGCGCAGAATCGTGGTTTATCCCCTGATAGTGAGCAGATCTGGAGCGAGCGAGTTTGGTGAGCTATTTGCCGGGTGTGAAGGGAGTGCAG
GCTCCAACTCCTGGTCATCTTGAAGAACCGAGTCAAGTATTGATGAACGCGGTCCACCCAGTTGTGCTTCGTTGCAAAACGAAACGCAGAACGTGAGTCC
GTGGACGTATTTTGTAGCGACTGCGCTTGAGCAGCAGATATGAGTGCGTCGAGCATAAAGAAGGTCGTATTGAGGCTTAACACCCCGCCATGGTTATTAG
CCTGCCCCAATTGTCCTCTATAGAGCAAGAAGTCCGGGAAGCCTGACACGTTTAGTAACTCAACAGCGCCCCGTAAGCCTATCGACGTTGTGTCGTATTG
GTACGACCAGATATTGGCCGAATCAACGGGGTCTGTTCCTGCAAGTCCGACAAATTTGTTCATGTCATTATCCGATCGCCAAATATGCCGGATCGGGTAA
TCGTACGGTCCGAAGCGAACAGCAGTGTCGGCCATGACCGTTCTCGGATAATAGTCATCAAGACGCCTCACACCGACGCCTGAGCGCGGGATATCTGTCG
CAAGCAAAACAATCGAGATGATCGAGATCACACAGCGCAA