Description :
From Genome Similarity Track
Location :
Scaffold_33:21992- 22995
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_33-snap-gene-0.33Phosphatidate cytidylyltransferase

Sequence
1003 bases(100 bases per row)
GAAGAACATCCCGTGGTTCCGCTCCATGCAGTGGCTCTGGTTCTTCGTGGCGCTGTTTTTAACTATGGCGACTCGTTTGGTGCGTTCCTCGAGACGCGCA
AGCTGCGCTTCGTACCACCAGTGCTCGTGCACTACCTGCGCTACCACACGTGGGTGTCGTTTGCCATGTACACAGCGTTGTTCGTCATGTCGGTGCTCAG
CCTGAAGAAGGGCTATTACAAGTACCAGATGGGCCAGTACACGTGGACCATCGTCACGATCGGCATGATTGTGTTCCAGATGAAATACGTGCTCACCAAC
ATCTTCAATGGTGCGTTTGCCTTCATCCTCGGTCTCCATCTCGTGGTCGTTCCTCACTGACGTCGTCTGCAGGGCTCTTCTGGTTCGTTCTCCCGGTCTC
ACTCGTCGTTTGCAACGACTGCTTCGCGTTCTTCTGCGGCAAACTCGCCGGCCGCAAGTTCATCAAGGCGCCGTTCGTGCGCCTCTCCCCCAACAAGACG
TGGGAGGGCTTCATTGGCGCGTTCATCTGCACGATCGCCTTTGGTTTCTTCGCTAGTGCCTACCTTGCCAAGGTGCGTCGTCTTCTCTTTCCTATGTCGT
CTCGTGGTGCTCACACCTTACGCTTTGTGTAGTTCCAATGGATGATCTGCCCGCTTGAGAGTCTCCAGCTGATCCCAGAAACGCTCACGTGTGCGCCGCC
TGCCGTGTTCACGCCGCAAGTGTTCACGCTACCCGAGGCAGTGGCGCAGTACCTGGGCTGGAGCGAGTTCACAGTGCTGCCGATTCAGCTGCACTCGATC
ATCTTCTCCGTCTTCGCGTCGGTTGTTGCGCCTTTCGGTGGCTTCCACGCGTCGGCGATCAAGCGCACATACCACATCAAGGACTTCGACTCGGTCATCC
CGGGCCACGGCGGTGTCATGGACCGCATGGACTGTCAGTTCATCACGGCGCTCTTtACGTCAGTGTACTACAACACGTTCATTCGGTGCGTGGCTTGTGC
GAT