Description :
From Genome Similarity Track
Location :
Scaffold_74:219907- 220920
Sequence
1013 bases(100 bases per row)
TGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGCGCGCTTACGCGCGAGGCTGCATCGATACTCGGCCTGCTGTACTAC
AGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCACGATGAGGATCTAAAGTATCGAATCCTCTATGAGGATCATGATACGCCCGTGGAGGTCG
GGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTTGGCACCTATGTAAGCACGTGTGAGACGTGTCAACGGACA
AAGTCCGCGCCGAACACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGAGCTTTGTGTTTGGCCTTCCCAAGG
ATAAGGCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGAACACCATTGATGGTGAAGGTACAGC
GTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTGTAGACACCCCTC
TTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCGTCCGCAGACCGATGGTCAGACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCC
GAAGCGTATGCGCTGAGGCGCCAAAACGCTGGGGCCAGATGCTCCCACTCGTTGAGTTCGCATCTAATAATGCAGTGCACGCCTCGACAGAATACACTCC
GTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACACAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGAT
GTCAGCCCTGTCGCGGCTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACA
CGCAGAAGGAACA