Description :
From Genome Similarity Track
Location :
Scaffold_19:219902- 222346
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10235hypothetical protein
Phypa_INRA-310PPTG_10236fatty-acid-CoA ligase

Sequence
2444 bases(100 bases per row)
TGTGCCGCACGAGGAGGTTCTTGTTGGTGCTTTTGCGCTTCAAACTCCTCTAGCAGCATCGATAATCGAGTTTCTAGTTCGTTTGCACGCTGCACTTGCT
CTTTTAGTGCTACTTCACAGCGTAAAGCGTAGAGCTCTAATGTCTTTAGACGAACCGAGGAATCCAACAACTGGTCGTCGGTCTCAGTGGCCGCATCAGA
AGACACTACGTGAACATTTGCAGCTTCGACCAGTTGAAATGACAGATCAGTATTCTGAGCTTGTAGAGACTCGATCATGCAGTTAGCACTCTCGAGCTTT
TGCCTAAGACTACTCGTGTAGTCTTCGTATATCACTGGACAAAGCACAAGGTTGTCGTTAGTATATTCTTCGCAGTAGATGCTAGCAAAGAACACACTCA
CTTTGCTGTTGGTTAGCCTCGAGTATCAGCCGTTCTTGTTCCAATCTGTGCGACGCCTCACCAGCTTTCATCCGTGCGAGACACTCTTCCTCAAAGTGCT
TAAACCTTTCCACAAGTTCTTGTTTCTTCACAAGGTTCTGCTCTCTCCAAGATACCAAAGCGTCGTCCCATAGACCAACAAGCTCATCCACTTTGTCTGG
TGCTAGCTGTAGCATGACTGCATTGTTGTCCCGCTCGGGAGATATCCCTGTCGCTGCAGCAGCAGTACGTAGTATAACATTAGCAGCCTCTTTATCCACG
AAATCTGCAATGACTTCGGTAATATCGTGGATGGCGCGTGCTAATGTCTCTTGAACCACTCGATTCTCACGAGCCTGTCTCTCCACGTCTCGCTGCATCC
AGTCAAGTGCCTTGCGCATATCGCTCTCCACTTTGTTCCTTCTGTCTGGTTCTTCGTATGCCCTCTCAACGACTCTCGTTTCCACCTCCCCTTTCGTGGC
TGTAGCAACAAACACACCCAAACAAATGTCAGACCCCGAGCTCTTCTTCAACTCGTAGCTTCTTTCTTACGGGTCTGCAACATCGACTCCGATGCAATCG
ACGTGTCATCCGACTCCACTTTATCATCAGAGCTCTCCTGCTGTTGCTCCTCGATCATATCGTCCTCGTACACGTCCCTCTCCGGTGTTTGTAGCACTGT
CGGTGGCAGTTGCCATGCTTTCCCGCTGAGACTCTCCCCCAATTCCCCCACTGACTGTCGTCTCTTCCTGGCGCTTCGAATCGCCGCTTGGAGTTGCTCA
GCAGCTCGCTGCAGCCGTTGGGAGACAACTGGATCGCCTCGCATGGTTCACTAGTGCAAAAGAGACTCTGCGCACGAAGGGTCACCGATAACAGGGCAGG
TCGTTGATTGGCTGCTGACGTTGAAGCATCCAGACCTCCCAAATCCGATATAATCCAGTGTAACCCATATCAAAATCGATATACGCTGGCTTCTCAATTG
GACCCATTTTAGTACTGCGGCCACAAGCGCGCAACGATGTCGTCGGAGCTGCTCGAGCGCGTGGAGAAATGGGCTGCCGAGACGCCCAGCAAGGTCCATT
GTCACCACATGATAGCCCATTGAAATACCAAGCTGTAGATTTGTCTCTAGGGGCGAAATTCTGAGGCGCAACGCCTCAAGAATCGCCTCCAACTTGCTGG
TATTTGGTTCTAACGCGTGTTTTCTCGCTGTTTCTTGCTGTAGACGATGCTGTCGTTCGCGGACGATAAGGGCGTCGTGACAGCCTCACTCACGTGCGCG
GTATGAAGCTTGTCGATGATTTATCGTCTTCTACTCGTCGAGTAACGCCTCACGATATTTTGCTCTGATACTTGTCGCGTTCGCCACTTTTAGGAGCTCA
ACAAGCGCATGCAGAACCTCGCGGGACTTTTACTAGCCTCAACGCAGCAGCATAGCAAAGGGTTCGTGCAGGATGCTACTAGTTTTGCAAAAAAAAAAAA
AGGAAAAAAAGGTTGAAACTAAACCCAACTTTTAAACAATACTTTGTGCAGACTGGGGCTGAACCAAGGAGACCGAGTGCTGTTGGTGTACCCGCCAGGC
TTGGATTTTATCGTAGTCTTTTTGGCTTGTCTAAAAGCTGGAGTGGTTGCAGTACCAGTGTACCCACCGGACCCTCGCAAGATGAAGAAGGACATCAGTA
TGTTCGTATCTGTGACGCAGAACTGCCAAGCCAAGACGGCACTGACATGTTCGATGTACTACAACGTCAAGAAGATCTCAGCGATCAAAGAGAAGTTCAC
GTTCTCCGGTGCTGCTCAGTGGCCAGAGCATTTAAATTGGGTCGTTACGGACGATTTGGTTGACACCAAAGGCATCGACCCAGCCAAGCACTGGCTCACT
CAGTCACCTTCTGCCGACAGTACAGCATTTTTACAGTATACTTCAGGCTCAACCTCTGCTCCCAAGGGCGTCGTGCTTTCGCATGGTAACTTGAACCACA
ATCTGCGCACAATCAGCTCGGCGCTCCAAGCTGGTCGAGATACG