Description :
From Genome Similarity Track
Location :
Scaffold_17:219849- 222232
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007116Similar to KIF2A: Kinesin-like protein KIF2A (Pongo abelii)
Pytul_DAOMBR144PYU1_G007115Similar to DSK1: Diatom spindle kinesin 1 (Cylindrotheca fusiformis)

Sequence
2383 bases(100 bases per row)
ATCTCATCGAGCCGCGTGATGTACTTGTCGATGTCGTAGTCCACGACGTTGTCGCCCTGAATCTCTGCCAAAAGCTGCCCTTCTTCCGTCAACAGCTCGG
CGCTTTCCTGCAATAGGAACACAAATGTAGCCATTCAGAAAATGTGAAAAGAACGCGGTTTATGTGCAGGTGCGCATAGACTCAAATGGAGACCTGGATG
ACGTTCATGTGCAGGTTCAGCAAACTTTCTTGCTCCTCATACACCGTTTGGACCTGTAACGTGGGTTAATAGTTGCCAGCATTAGCGCACTCAATACCAA
AGCACCACACTCGGTAACGTACCACGCCATGAAGCGTCTCGAGATCGTATTCGTTGGAGCTTTCTCCATTCGACCCTCCTGTGGAACACAAAATGAACGA
CCAGTTGGTAAAACTACACACAGGCGAGACCAAGGCGATGTGAGTGAGACACATACGTGAGTGCTTCCGCAGACTGTGATGCAGCATCTTGATTTCCTGG
CTCGATTCCGACCGATAGCGATGGGCTTCTCGCAACTCGTCCTCACCTTCACCGTCGCCATCGCCTTCTTCGGGTTGATCGTCGCCTCCCTCGTCGTCAT
AGAGTTCGTCGTCGTTTTCCTCAAGGCCATCGTCTTCATGCACTCGCGTTGGCGAGTTTGACCCATCGTCAACGTCTGCTCAAAAGTCAGTGCTTTACTC
CAGAGATGATAGATGTTAAACTATCGCTTCAACTCACCCGTTTCAAAGTTGACATCGTCCAAGTCAACCACAGCGACATCAGCCCCGCCCTCGTCGAATA
CGTCGGCAGATACACGCTTCTCCTTGACCCGATCAGCGTAGCGGAGCGTGTTGACCGTGTGGTCTGACGACGACGAGCACGGAGACACTGCTGCGATCAT
TACGGTTCTGTTGGTTGTTCATTTATCAATGATGACGAGATGAGACCATGATCGGTATCCGGCAACGTCAACAATGATCCCTTCTTCGCACGTACCTTGC
TTTAGCGTTTACGAATGAATCCTTCAGCACTTGGGTCAGCTTGCTTGCGCGAAACGGAATATGAGTGCCACGACCACCGCTGTCCAGTGCTCTGTTGTAT
CGGCAGAAATATCGTCAATCGCAGTGTTTCTGCAAGTGAAACTAGAGCAACTATATCCGTACCGAAAGCACTCCTTCAGCGCCAGCAGACTCTTGTTGAT
CTCCGACGACTCCATTCGACGCTGGCGGTTATGGTTCTTTGTATCTTGACCGCGTTCGCTTCCAGCTAAATCAATCAAGGACAGTTTCCCATACAATTGC
GTGCTTCCTCTTTCGCGGACCGTGATCTGGCAGATGCAGTGCGAACGGGACGACACGTCGTTCATCTCTGTCGCGTGCGTGGTTCGCAGACTGTTGCCCT
TGTTGATGATCTGCAGCAGCTCCTCCGTCGTTGTCGGCTGCACTTCCTCCAGGTCAACAATTTGCACTTCACCTGCGCCATCCTCGCGGATCGTGAGTCG
CTTCCGATGGAGAAGATCTTGGCAGCGGCCGCCATAAATCTCAAAGAAGCTCACCCACACCTCAAGAGGTACGCCACTACAACCATCCAGCAGCAGGCAT
CAAAGTGTTTTAATGCACAACTTGCCAACAAGGCATATCAAAAGAAAAAAAATCAAGTGCACCGTTGCTCGAAGGCATGCACTTGCGCAAACACGTCCGC
TGCAATTTGCTTCTGGATTCCTTGCATCGTGTGCGTTTTCCCACTTCCCGTTTGCCCGTACCTGCAGTTTCATGCGCCAGTTAATTAGCCTTTCAAGTAT
TCCGCATTCACGTATCCATATTATTTGGCGTCTTCTTACGCGAATACAGTAGCGCGCCCGCGATCCTGGAAGACAAATTTGACCAGCGGCTGCGCCGTGT
AGCTGTACACGACTTCGTTTGGCGTCGTTTCATCAAATGTCTGGGCCAGAAAGGAGCATACAGCTCGCATTTAGGCTCCATACAATGCACCCAGATAACA
GATAGAGTAGCATTTGCACGAGTAACGTACGTGGTCAAAGCTGAACGCGTTGCTGTCGAGGTACTTGGTGATGCCATCCACTTTCAACTTGCAGTCGTGG
ACAATCGCCATCGGGTTCAGGCACGTCACGGCGTCGTAATCGCGTTTCTTCACCTCCTTGGTATTCACCGGGCGCTTACGCACACAGATCGTGATTTTTG
TTTCCCCAGGCGGCGCGTGCGGCTGCTTCTTGTCGCAATTCTGTTCTCGGAAGCCTCGGATCATGCGCTGAAAGTCCACATCGCCCGGATGGCCCATCTT
CTCGTTCATCATGCTCTCGACCTGCCGCTCTTTCTTAGCCACCGCCATCGCGCGTCGCCGCTCTTCACGGTTTTTCTCTATCT