Description :
From Genome Similarity Track
Location :
contig_47:219840- 265215
Transcript NameFunction/comments
g7857.t1hypothetical protein
g7858.t1DEAD/DEAH box RNA helicase, putative
g7859.t1hypothetical protein PHYSODRAFT_313194
g7860.t1hypothetical protein PHYSODRAFT_465114
g7861.t1hypothetical protein PHYSODRAFT_313196
g7862.t1hypothetical protein PHYSODRAFT_354318
g7863.t1hypothetical protein PHYSODRAFT_497615
g7864.t1hypothetical protein
g7865.t1hypothetical protein PHYSODRAFT_489198
g7866.t1hypothetical protein PHYSODRAFT_345503
g7867.t1hypothetical protein PHYSODRAFT_354319
g7868.t1conserved hypothetical protein
g7869.t1hypothetical protein

Sequence
45375 bases(100 bases per row)
GTTGTTTCAGCAACACAATCTCCCTTGTCCGCCTCCAGTTTCAACGCCACATACAAGTCGCGGAGTTTCTGGAAATGGCAGCACCATTAGTTCCTGTAAC
GACGATCTCTTACAGGTGGAAGTGTGTCGGTGCGATTGCTTACCTAGAGCTCTCGCCTGTTATGTACTTCTCGAAGGCACCGACTCGGAGCCATCCACTC
TTCTCGGGGCCTCCAAGAAGAGTTTTCTTGGCCAATAAGGTGGTTTTTGTCTCCGACTCGGCAACTCATTTCAACCGTTCTTGTTGAGGTTCCTACTCGA
GATGGTTGTGTCCACGCTGAACGATGGATATGAAAGTGGCACCATGGAGTCAGCATTTTGTCTGCAAAACCTTAGACCTGGAATGACACGATCTTCACGA
AAGGTCGTCTGTCGCCGTTGAAAACACGCCAAGACACCTTCGTCCTCCCCGATGCGCTGGTCTCCACTTGTGCTGCTTGGCCTTCTCTTTGCCATCTTGC
AATGTCTAGCGTGTTGCCACGCGAAAACGATCGATTATGAAGCGCTGGAAAAATCGTGGGAGGTTGGGGACAATGATGCAGAGCTGCGCACGGAAGGAGC
CGAGCACTATCGGCAGCTTGCAGACAAGTGAGTGTACCATAGCCCACCTTGATACAGCATGCAGCTCCAGCAAAACTCATTTGTTTGCCCTTTTTATCAG
GAGCGAGGAACAAGCGAAGGCTCTCGGTCCTCAAATGATATTCGTAACGATGAAACACGGCGGCGATCAACGACGAGAGCCTCTTCCTGGCGTTGCAGCA
CGATGGAAAGAGGTAAGATTATAAAGCGGTGGCTGCATGCACTAGCGAACTTGTAAGTACTTACATGGTTGGTTTTTGCAGATGCTGTGGAATGGTGGGA
TCGAAGTGAACATCTACGAAGTTGCCGAATCGAAGCTTCTCGTTGGACTACAGAAAGGCATGTTCGTCAACGATGTCATGCGCTTTCTCGACCAGCAGCG
AGACGTGAGAGAGTACGAATGGAACGGCAAAACGTATTCACACAGCACCAAGTCGACCAAGCTTAGCCACCAAAACCACCGTCAGAAGAAAACGAAAAAG
GCTCACCGAAAAAAAGCACACCACCCACAGTCTAAACGCTCAAAACTAGGCCATCACGTGCACATGAACGGAAAACAGCCTCGCCCTAAAACTCCTCAGC
CCGCATTCTCTGAAGACACTGCACAACCCAAGATGACAGAACCTCCCCAGCGTAGCGGGCCAAACGATGAGCTGTGACATTAAGGTCAAATGTTTATCTG
AACACAAATCCACTCATTTCCACCATGCTCAGCTCTTTGTCTCTTGTGTCGGTTCGGCTTAGTTGCTCGTGCGCTCACTCCGAATAGTTTCAAGCAACGG
GCCCAGCATCTTGTTCTTCTTTGCGTTCTCCATCACGGTGTGCAGTCTCGGGTGGGAATCTGCGTCACGCACAGCGCTGATCGCTTCCAGAGCACGTAAC
GCGCTACGAATGAGATCCTTCACGCGCTCAACCTCAGGCCCAACCTGGTCCTCTTTGACCTTCTTGTTGATCGTCTTCTCCAGCGGCTCGACCAAAGAGT
CCAACGCACCACAATACTACCAGGCTGAACGTAGCAAATCTTGATCAAGATTTGGTGACTAAGCATCTGAACGTCGTCCTGGTCTCCCAGACCGCGCTTC
AGCTGGTCGAAGAACAGCGAAATATCCAGCTGCTGCGGTAGCACCTGGATCAGTGTATCCACACACGAGTACGCAGCCTTACGGAGCGGAAGCCCATCAT
CCACCTTGTGTTTGAACGGACCGAGGTCAACCACTCGCTCCAACTTAGTTTCTGTCGCCTTCAGGAGCACTGGAAGATGCGCTCACGGACGTACGGCACC
AGATAGTGCGCGTGGTGGTGAGCCGCCGTGTTTAGCACCAGCAGGGCAGCCCGGCGCACGTGCAAATCTTCGTCTTCAAGCGCCGCCAAGAAAGGGTCGA
TGTGAGCGAAGATCGCGTTGACCGCAGGCTCTTGCGCCGTTGTCGTCATCGCATACTTCAGACTTGTCACGGCGGTCCAACGAGACCATACGTCAGATGA
TCCGCAAAGTTCCGTCACAATGGGCATGATTTTTGTACTGTCCGTCACGGCGAGTTTCCCCATGCATTCGCCAACCATATTGCGCACCCCTCTTCTTGAC
GAGCACTCATCTTCTGTAAAACTGGCAGCACGCGGTCTACATACAGCGCAAAACCGTGGTGAGGCTTAGCTGCGTGGTCCGAAATGACTTCGCGTAGCGA
CGTCAGCAGCAAGTAAGAGTTCTCTCCAATCTCCAACTTAACCATGATAGTGTCCAGGTACTCTTCCATGTTGCCAACGCAGATACTACCGAGAGAGTAC
GCTGCCGCAGCCTTCACTTCCTCGCCCGCATTACTGAAGCACTTTAGAATCGTCTCCTTCACGTCGGTATACCCAGCAAGCTTGATCTTGCGGCCGAACT
CGCCCAAGCAGTATAGCGCAAGCACTTTGTTCTTTTCGGACTCCGTTTGCGTGATGTCACCTACAAACTTAGCGAATGCCACCTTGCGATTCGTTTCAGT
TGTAGCCACACATGTACCAGCAACACACCGAGCGATGTTAAGCACAGAATGTTTCGATTCTTCCAAAGGTGTCGCCATCAGCGCCTTGAAAAGTTCGGTG
AAGCTGCTGCCCGGAGAGTTCAACTGTGTGAGTTGCGCGAAGAATCCCTTCAGTGCATCCAAAGTAGGCCCCTGGAGCATGGAGCTATGACAGAGCTCCA
GTGCCTTCACTTGAGCATTTTGCAGCAAAGCGTCTGTCGCAGCAACGTGCGGACACACGCGGAGAGAGTTTGACACCAGCGTAATGCTCATGCGGCACAA
TTGAAGGTCCACGTCGACAAGAAGGAGCGAAGCTTCTTGGACAACTTCGTAGTGCAGAGACTCCGGCATGCTAGCTCCCTTGCGCACAACCAGATCATTT
AGGGTAGCCAGTGTCGCTTGCTTCAACGTGCGAGACTGCTGGCGAAGCAGCTGGGCCAGAGTTTGTGTGCACTCCACCAGAATAGGGGACATATCCAAAT
CGAGCTTGGAGCGAGCAATGACTCCGATGGCCTTGATAGTCTGCACTCGCGTGATTTCGTTGTTGAGACGCTCCATGAGAAGCGGATAAATTTCGCCCAC
CCGGGGACCAAGTTCGTCACCTACAATCATACCAGCAAAATGTTAGCAGGGAACACTCGCTTCGTGAATAAAGTTGTCGACAACGTACCGAGGACAGCAA
CGATCTCCCCAATACTGCTGATGGCAGCCTCCTTAATCTCTTGATCGATATCATGAACCTTCAAGCTAGGCAACACCGCTTCGAAAAAAGGCACAGCGTA
CGGCTTGTACGCCATGTCTCCATCGTCAACCCGAATAATGCGGACTAGAGACTCAATCAACCCCAGCGCCTTTGCCACCGTTTTGTACCAGTCTCCCTCG
CGCATTGCACTGCAACGTTGATGACCGAATCAATATGCGGTCGGAATGGTTCCACCGTGTGCGTATCCACGAGCAGTCGGAGAAACAGAAGTGCATCCAG
CTTTAAGTCCGAGTGCTTGTCCTCCACTGCGTTTAAAATATTCGGCATCAAACGTCCAATGTAGTCTCCCAACTTTCCGTGCTCCACCATGGCGAGTTCG
TAAGCATCGCAACTACAGCACATCGCGACGGAACTGAAGACTTCGTTCCAAACTGCTTGTTGGCTCCAGCCACGATCGTGTTAAGGCGCTGCTCCAACTG
CGTAACGCATCCGTTCGACTTAGGTGGGTGAAAGGAACCAGCTCCATTTGAGCTTGGAAGTGTCTTGTGAGTCGCACGAAGAAGCTCTGCAAATACGCCA
AACACGTCGATCCGAACGTTTTCTTCTCGCTCTTTGAAGCGCGAAATAAGGGGCTGGGCACAGTGGATGTAGAGATGTTCCAAAAGCTCTGATCTCGTTG
TGATGATAGCAGTCAAAACACGAAGACTGGCACGACGGACCTTCCAGCTGGTGTCGTCATCGTCACTGTAGTCGCCTTCCTCATCACTGTATTCCTCCTC
TTCCTCTTCCATGTCTTCATCTTCGTCGGCCGAGTCGACATAGTTGTAGTTGGGGTCGTACGAAATAAATTGCAGCACAAGCTTCAGAATAGCTTCAACG
TGAGGCGTGATCTCGTTATGGCATCGAACGATAAATGCTTCAAACGCCTGGAAGCAGTTGCCTCGAAGCTCATCTGAGTCTTCGTTTTGCAATGACTCGT
CCTCAGGGTCTCCGCAGAACTGAACCAAGATTGGATCACGGCGTCCAAGTGCCGCCCAAGACGGTGGCCTGCAGTGCGCGAGAGCATTCCGATCGTCTGG
ATCAACGTGCGCACATTCGCCGAGTCGGTTGAGCCCTGAATGCCCTTGATCAGGTGCTCTACCAGACGGCTCACCAGCACGTCAGACGCCATGACACCCA
GCGACCCCACACAAGCCGTGGCCCGCTTGCGCACCAGCGGCGATTCGTCAGTCAGCTGCACCATCAGCAGCTCCATAATCGTCGCGTGCTCCGTTGCGAC
GTCGTAGCCAAATCGACGCAGCAGGTCCGTGAGGATGTCAAGCGTCTCGGTCTTGACAGCCGCGTCCTTGTCCTTGCCCAGCCCCGTGAACAGACGCGTG
CAGATGCTCGTGGCAACAGACGCTCCCGTCGTCTGGGACACGTCCGCGACGATGGTCTTGAGTCCAATCGAGTAGATATCCCGTAGCTCCGGCTTGCCGT
TGAGAATGAGGTCGCAGAGCTTGGCGCAAATGTCGGCCACCTGCGCTACCTGCACTTTGGTCACCAGGACGCCCAAGCACTTGACGGCGATGGACTGCAC
GTCGTTCGACTTGTCGTCCAGTTGCTTCAGCACCGCTGCACACACTCTCACACATTTAGCCCCTTTCCTCAACTAGAAGAACTACAAGCGCCTTACTTTG
GCTCGAGATACGGCCCCAGCTCCACGTCCTTGTTGAGCTCGCTGCACAGATCAGAAGTGGCCATGTAGCGCTCATCCTTGTCAAAGTCCGTGGTCTGCAG
CACACACACATACATCAGCACCAGACCCCACTGGCTACACGGAGCGCACCTTGTCCAGCAGCTGCGCGATCTTGTCCTCGTTCGCGCGCATGTTTCTCCT
CCTCCAAACGTGAAAGCGAGTGATTTGAAGGATCTCGGGATGATCATGTGCACCACATCAACGACCATCACTCTGGAACCGTTACTTCAACGTTCGCGTT
TAAGCAAGCGACGCCCATGAGTGCGACGCGCTGCTAGTTGCTTGCCGTATATACGTCGATAAGCTAACATGTCTGCTGTGAGTGTGCGCAGGCGAGAGCG
ACAGCACCGTGGTGCCTGACCAGCTTGCGTCCCTCATTTCGGATGAAGTGGAGCGCCAGCTGAGAGAGCGCGGCTCCGTGCTCGAGGCCATGAAGGAGCA
GATGGCCAAGGTGCTGGCCGAGTTCGAGGAGATGGCGGTCAATGTTAGCTCCAAGCGCTCGTGGTCCAACAGCGTCGCGAGGACGAAGCCCTTCGCCTCG
CCCAAGAAGGCGCTCTTCGACATCCACCCGGTCGTCACGCCCCTGGATATCGTCCCTTCTTCACCTCCAAAGCTGCCCAAGTAGGAGCAGTGCAAACTGC
AGAGTGGAATGGATGTGCGTCTCACCTGGGTGTGTATACTTTTGCGCAGGATTAGCGGCGGCCTGCTCAAAAACATTCATCAGCTTAAGCACAACGCTAG
TGGTGGTGCCCTACCGCCAGGCGGAGCTCGTAGTCCCGACGGCAAGATCACGTTCGGTAAGCGCTCATACTACAGTGTAAGGAGCGTGTCCTGGATGGTA
TATTTAACTACGTTGTTGACCTCTAGACAAAATACTTCCTCGAGTTGCTCACATTGAAAAACGCACTGACGGTGCACAGATGATGTTATCGCAGCAGAGA
CAGCAGATGTACGAACGAGCTCTGGTACGATATCCGCAATGCCGAAGCAACGTTTTTGCTCCCAGCATGTATGATCACGAAGAAGTGTCCAACTTGGATG
CAGGCTCAGCACCTCAGGCACCCCGAGCGTCACTAGAGCTTGATTTCGTATATGGATGCCGAAGTGGAGCCACGACGTCGCTTTCCAGCAGCCATCCTGC
AGCAGCACCTAACACTAGTACCAACAACAGCGCTTTCTACCTGTCAACTGGTGAAATTATGTGGTTCGCAGCGACGTTAGTGATTCTTTACAGGAAAGAA
GCCAATACCCAGAGGTATTTCCGGGAGCACACGAACGAGGTGACGAGTATAGCAGTTCACCAGAACCAGCGCATTGTAGCATCCGGCCAAGCAGGACGAT
CGGCGTTTCTCTTGGTATGGAATGCGAACGATGAACCGCTGGGCAAACGGTTTGCGTGCCTCAAGGGCCACCAAGTGGCAGTGCGCTCCATCAGTTTTTC
TCATGACGGTAAATTGATCGCTTCGTTGGGTGGAGATATGTACAACACCATTTGCATCCACGACTGGAAGGCGCAAGAGTTATTGGTAAGTGCTCGGGGC
ACACGTTTCGGGTTCATGCGGTTGCATTTAATCCTTTTCAGGCATACGGTCGGCCAGAAACTCAGCGATCAAAGAAACCTGGCCAAGCTTTGCACGATGA
CGATGCATGCTACACCCTAGCAAGCTGCGGCGTCCGGCATATTCGCTTTTGGACACTGACAAAGTGCGTGCCCCCTCCATCAAAGGAAAATGTCGACAGT
GCATTTTCACGCTCTACATTTGGTGGTCCTCCAAGATTGCGTCCTCCAACACCGACTGAGAAGGTCTGGAAGCTGGAAGGCAATGTTCCATCGTTCCATG
GTCGATTTGAGGTTCAGGACTTTACAAGTTTAACGTTTGTGAACGATTCACCACCTCTGTATATGTATGATGAACACTCCAAGGAGTTGACGGCCACAAA
CGCTACTGATCATTCGCTGGGTCGGATCGTAGCTGGCACGGCTAACGGAGATCTGTGTCTGTTCTTGCAGCCAAGGGCAAGCCCCAATATTGATTTCGTT
TCCGAGGGTGATCTTCACAAAGAGCCTGCAAAATGGTGGGAAGTTCCAGACGAATACACTGATGCTGAGATCAACGAACTCGTATTAGAGAAAATCGCAT
ACGAACCAACAGCGAGACTCATTGATATCGTGCCTCATGACCAAGAAACTGGTAATCGATTTAAACTACCTAAACAAGCTCAAGCGGAGATGCAGAGTTT
ATCCAAGAAAATGGCGTTGAGGCCCAACTCAACGGCCTTGTTCTCACGGCTGGGTGAACTAAAGTATAGCGGTCCGTTAGCTCACCAAGGAGCAGCTTAC
CAGGTGGCGTACTCCAAGAAACGCAATACGATTATTTCATGCGGAAATGAAGGCAAATTGCTGCTGTGGAAGTGTGAAATGAGTAAGCCGCTACGAATCC
CTGGAGTTAATACGTTAGGAGTCTTCACACCACTGACTGGAACATTTACAGAGGGGTCTCACGCGCTACTTCCACTCGATGAAAAGGTATTCTACTTCCC
AACTATACTACCACATGAAGCGAGTGCGGGTAGCGCTGCTGCTGCACCCAAGCCCACAAGTATTGTATGGAAAGATGACGGGAACTTCGTGCTTGTTGCC
ACAAGCAATAGCTGCGTTTGGGAACTAAATGTCGAGTCCGGGGATTGGCAACTACTGTTTGAAGCTCGCAGTGGAGCTGTGACAGCTTGTGCTGCACATC
CAACTATGCAGGAAGTGGGGACTGTATCCCAAGACGGATATCTTAGCATCTGGGACCTCCGACAGCACGTGTGCATTCGCCGCCTGTATCTTGGGAGCTT
CATCACCGCTAGTGTCAAAGCCTTTTGTATGGAATTCCATCCAGCTGGAAGCGAAATCGCAATCGGGCTCAGCTCAGGCGAGCTACTTGTTGTCGACTAT
GATTCATTCAAGGTGTTGCTCCGGAAGAATATCAAGTCGAACTCCGGCAGCACTGCCAATTTACGTCTCTCCGGTCCCGCGTTTCGAGCAATTGCTCAGG
TGAAATACTGTCCAAATGCAAAGTTCTTGGCAGTGGGTGTAAAGGACACTTTCGTTTACATTTATGATATTGTGAACGGGTACAAGAAACTTCACATTTG
CGAGGGCCACTCAAGCGCTGTGATGCAATTAACTTGGAACAAGGATGGCGATATCCTGCAAAGCAATGCCACCGATGGTGAGATTCTCCACTGGATAGTA
TCTCCTGTTAAGGGTGAAACCAAACAGATTACTGATGCGTTTCTCGTCCGCGACGTTCAATGGATTAAATGGACCTGCGTGTTCGGGTGGCCTACGCCTG
GCATTTGGTCCGAGGAGTCACCCAACCTTGTAGACATTGCAGCAGTCTCCACTACAGGCCCAAGGACTGCTAATGAGTACGATGAATGTGGAAACGCTCA
CACCACCTCCAACGAGGACTTGCTGGCAGTAGCGTGTCGATCCAGTATTCATCTTTTGAAGTACCCCGCTCATCGTGGTGCCAAACGAAAGGTGTACAAG
GCTCATTCGTCCGCTATTTCAGCATTGGGATTTTCATTTGATGATGCATATTTGGTTACTGTTGGTGGAGATGGAACTCTCATGCAGTGGAGCGTTGTGT
TCGATACAACAAGCTCCAGCCCTGCTGGTGTTAAAGTACCAGGTAGCACTGGAAAAAGATAAATCCCGGACACCATTTGCAGAAGATGATAGCACTGGAG
AGCAGTGGTCAAGTTCGAGTCCTGCCCCTCCCCCGCAGGATGGCAAGCAACGATCAAATCAATTGTCTCCTCGAAAAAATTCTCGGCAGTACCGCGAACG
CCTAGTTTATCAGGACGATAGTAGCCGAGAACCTGAACCAGTCGGTGAAAGCGTGCATCGACATCCGAGTGAAGAAGAGCCGATAAGCGATATCCGCAGC
GACAATTCTAACGAGGACAGGAGTTCTCAAGCAGGTGCCAGTGGTCCACCGGTAGAGCGAGGTGTCAGCTATCGAGGTAGTACCGATCTCGACGAGCCCC
GTCCTGCACCTGTCCAAGTTCGAGCAACACACGACTACGCAGCTGAAAGCCCTGACGAGCTTAATCTCAACCGTGGCGAGATTCTGCGCGTGCTCTCAAA
AGCTGGTAGCGATTGGTGGCTGGGCGAGACTTGTGATGGTACCAAGGGCTATTTCCCCGCTAGTTTTGTAGAAGACGTGGACCTTAGCGCTCCCGTCTCC
GGCGACGAATCCGTACCAAACGAGGATCCGCCAGCAGAAGGGTAACTGTGGTTATTAAGTTTACATTTGCTTCTGTTGCTTTGAAGTTGTGTCATTTGCT
GCTGTTGAAGTTGTCTGCGACGTGTGACGCAAGATGGCTACAGTTTCGGTGGCTCTAGTTGGCCATTTGCTCTCATGGCGACACCGCCGTCGGACACGGC
GCTGGGTGCCACCTCGACGACGTTCAGAGACCTGCCGCTGCACGAAGATGTTGCTCATGCGCTGACGGCCATGCGCTTCCTGCGCCCGTCGCCGATCCAG
CTGCATGCACTGCCCGTGGCTCTGTTCGGCAACGATGTCATCGGCCAGGCCAAGTCGGGCACTGGCAAGACTGCGGTCTTCGGAGTCACCGCCATAGAGC
ATTCGATTCGTTATGTGGAGCAGCGCGGTCAGCAGACAGAAGAGCTGATGGTGGGACATCCATTAGCGCTCGTTCTAGCGCCCACGCGAGAGATTGCAGT
CCAGATCGAGAGTGTACTCCGTCAATTGGCGCAGTTCCGACCGAGCTCGTCATTCGTACGTGCATCGGCGGTCTACCAGTGGCGCAGGACCAGGTAGCGG
AAGCAATACATACGCATTCAACCGGTAGAAGATTGAATGGAGCTGGTATTTGATGTTTGCAGATGCACCTGGCGGCGGGCTGTCACATTGTTGTGGGCAC
GCCTGGGCGCGTGAAGGCGCTTGTGGATCAGTGCTCACTGCCGTGTAGTGCAATTCGACTGCTGGTACTGGACGAGGTGGATAAACTCATGGCGCGAGAC
TTTGAGAAAGATGTACGACTGAATGGATGACATTGGTTACTTAGCTAGGGACTGATTGCCGTCATTTCGATGCGTGTACAGATCCAGTATATCGCGGACG
CTCTCCCTGAAAGACGACAAGTAACACACTGTCTCTGTGACGAAAGCTACATGTGATAGTTACGTTGCTACTTTGATTTTGTGGATTGCAGACCCTCGCA
TTTTCTGCCACGTTCACACCCGACCAGTTGATAGCTGTGACCCAACTAATGAGGACACCACAGGTATGTTGGAAGGAACTATATCATGAATTACCCAGTT
CTCTATATACCTGATGATACTTTCTCGCTTAGATTGTGCGCGTTCGAGGCCCGGGTGATGTAACAACCGAGTTCATTTCTTCCGCTGAAGATCTTTCAAA
CTGGAAGGACCGAGAGCAGTCAAACGCGCCTGAACTCTGGCTTCACCATGTGCGACAGTTCTATAGCGTCGTCAAGTCCGCGCCTGCATCAGCCATGGGA
GATGATGTATTGAATATGAAGGCGAAGGTAGTCAAGTTGGCAGCGCTGCTGTCAGAAATCGTATTTGTGCAGTGTATGGTGTTCTGCAACGACAAATTTC
GCGCGGAGGCACTAGCCACAGCTCTTACAGCGCTAGGCTGGCCAGCAGCATGTATCACTGGAGCTCAAGCTCAAGCTACCCGCCTGGAGGTGATGGAAGA
CTTTCGCGCATCCCGCTCGCGTGTGTTGGTAACAACCGACCTCACCGCGCGAGGTATTGACGTCGACAATGTCAACTTTGTGGTACGTTGTGTGGAAAGC
GATATATAGGCGTGTTCAATTCCTTATCTATGAACTGGTAGGTGAATCTGGATCTGCCACGTGACCCAGCGACGTACTTGCATCGCGTTGGAAGGACTGG
TCGCTTTGGCGGGAAAATATCCTTTTCATCATGTCTCCTGCATTGATACGGTTGAGTTTGCCGGACCTCACTGATTCCTTAACCAAGAATTCTCTTTTGT
GGTTGTTGTGCGTGCTTACGGTTTAGCAGTGACGCTGCTCTCTAGCAATGAAGTGCAAGGAGTCCATCTGCTTGCTCGAGTATTCAAGATGAAGATCAGC
GAATTGCCAAGTCCAATACCCCGGGAGATCTACTCATACGCAACTGAAGAGGAAAATGATGACTGCAGTGGCGAAGGAAATGAAGACCCTTCAAAATCTG
CGGTGACAGGAAAATTGCAGAAGGAAGATCGTACCGCATCCCATGAACATGAAAATGACGAGGAGAATGCCCCCGACTGCAGAACAGGTCGTCGAGGATA
AACCGTTGTCGAGAGAGACCTCAAGTCGTTATGAGAGGGAGGAAGGCTCGTATGAGAGCTGGGTGAAGTTGCTGTAGCCGAGCACGGCGCTTACTTTCTG
GATCTACGAAATAAATGGCACAATTTTGACATACAAGTAGTTGATTGATGTCAAATATGGGGATCTCGTGCACCGAAAAACTAGCCGAACTTCTTTACGA
TGCGACGCAAGGTGTTGACGGTCCGAACCGTGACTGGAACACCGAGTTTCTTGTCGAAGGCCACTTTGAACAAAGGGGACTCGCTCATTTTGGTGGTGGA
GTACCAGACAAACGCTTTGTCGAGCAGTTGAAGCTCGTCAGCTGCCGTGGAGAGAGACTCGACGATGCCTCTCTGCTCCTGAGTCAGCTCTTCTTTCACA
AGCACCACATTGACCGCTGTCGCCACCTTCACAACCTGATCACCTAGTCGTGCGACATCGTCCATGGAGCGAGCGAGCACTGGAATGTGGCACCCGAAGA
GCCCTTCGAGCGCGTCCTCGACTTGGTGTTCGATGGCAGACACCGAAGACTTGTTTTCTCCGGCGGGTGGGTCGAAGATGACGTTCCCGCTGGCCAGGAA
CGTCTCGACGTTGCCGAATCCTGCCTTGCTCAATGCGTCGGCAATCGACTTCATGCTGTGCACGCGGCCTCCGACGTTCACGCCTCGAAGGAACGCCACG
ATCTTCCTGGTGGTGTAGTCGCCGACGTAGTGTCATCGGATGCATGCGCTGGTGGGCGTGTGTCCTCAATTGTGGTGGGTTCGGCAGCAGCAGCAGTAGC
AGTAGCAGTAGCAGCAGTACTAGCGCGCGTGACTCGCTTGACTTTGGCTGGGCTCTCCGTCCCAGCAGATGGAGCCTTCCTCTTGCCGCCATCGCAGCGG
CGACTCTCCAGCGAAGGTGAGAACGGGCTACTGAGATCCATCACAAGCCATGCCTCTGCCAGGAATGACACGCTCGAGTACCAAAGCGCAGCCATTCGGG
CGAATCCTCACTTGTGCAACTTGCAAGATGCGGTCTCTCTTCGTCCACATCTGTCCACCATATGCAGCCTGCATAATCCTATTTAAGTCAAACATATAAG
GTATCATCGTCAAACTATACATTTGTAAGAGTATCTATATCACCCTCTCTATTGCTCGCCCGTCTACTGCAATCCCTGTCTAATAAAGCGCGTTGTTCCG
CCCTTCTTCGCAGGCGGCGTATAACCGACTCTTCCTCGCGGTTCTCGCGCTTCAAGCGTCTCTCTCTCTGCCGAGGCGTCGCCCCCTCCGCCTTCGCTGC
CACATCAGATCTTGCCTAGTCATGACCACAGGGCGTCGAGCCGTCGTCGTCCGCGACCGCGTCGTCCACGTCCTCCTCCGTGACGGACAACAACGCGTCT
CTGCAGCAGTATATCTCGGCCAAGGAGGTGGCGCAGCACCAGGTCTTCCGTCAGCACGACTTGCGGCGCTCCATCAGCTCCACGCAGTTCAGCGGTGCCT
CCAGCCCGGCGGCCAACGGCTCCAAGGCCTCGGCCGCCGGGTCTTCCATGTCGGCCTCCAGCAGCCCGCGCTGCTCGTCGCCGAACTCTTTACCCGTCGC
CGAGTCCATCCTCAAGGTGGTGCTCATCGGCGACTCTGGCGTGGGCAAGTCCAACCTCGTCACGCGCTTCACCAAGAACAAGTATATGCCACACAGTGTA
CAGACCGTGGGCTTCGAGTTCGCGACCAAGACCATTCGCGTCGGGGACCGACGACTCAAGGCCCAGATCTGGGACACTGCAGGACAGGAGCGATTCCAGT
CGCTCACTGCCGCCTACTACCGCAACGCGGTGGGCGCCATGATCGTGTACGACATCACGAACCGAAGTTCGTTCGAACACGTCACGGGGTGGCTCGCCCA
GGTGCACGAGCACTCGCACGAGAGTCTCGTGCTCATTCTCGTCGGGAACAAGTGCGATCTGGCGCACCTGCCGGAGAGCAGAGAGGTGTCGACGCTCGAA
GCGGCGAGATTCGCTGCGAAGCATTCGATGGAGTTCCTCGAGACGTCTGCACTAGACTCGACGAACGTCGTTGACGCCTTCAAGAAATTGATTGTGCCCG
TGGGGCGCCTGCTGTCGCCAACCGAGCCAAAGAAAATCGCGCGACTGCCGACAGGGTGGCGGCGCGTGCTCTCAAGAACCAGGCCTGGCGAATACTCGTA
CGAGAACCAGTACACCAAGGAGCGGATCTCGTTCGCACCTAAAGAACCGGCGAAGCCGTCGCAGCAGAGCTTCCGAGCGTCGAACGGGTTAAAGAGGGTC
ACCGAGTGTTGTCACCGTCACACGCGAGAGCCTCCAGAGGCAGCATCAAAAGGCGTATCTCGCACAGAATCAGACACCCCAGTGCGGCGTCTGTGCAAGC
AACTGCACTATATTGTAGTCATCGGACCGATGATGCACGGCTTGCCTCCAGGTCATCAGCCCACAGGCAAACCGTCCTCTTTTTCTCCACCAAGCCAATA
CAAGTCAATTACAGTCTGCGTGCTGACCCAGGAACGTCGCAAGAATGCGAATGGAGGGTACAGGGTCGAATAGAAGCAGGCTCACTCATTGGAGATGTAT
TTTCTTCAGTATAAGGCTTCGCGTTGCTGCGTGCAGCCGATCGCTGTGGGTGTTGGTTAGCCGCCAGTTTTGTGCCTGCTATCCTTTCATAATGCTGCCG
CACACATCTGGCAATATTAAGTTTACAAACATGATGGACATGGTTGGTTGGTCTCTATGAATGTTCCCACCAGATAATGCTGCTACTAACCACGCACTGC
TCATCGCTCGCTATTGCATCATCCTACTGTTTACTTCGAGCGCCGCGCAACGAAGAACGCAGCAGCGACGGTCGCAGCAGCGAGCGCGAGAGTGGCGAGC
TTGCACTCAGTCGGAGCCGACGTCCACAGCCAGGCACACTCACTGGAAGCCTTCTGGTTCTTCTTGGCAATAATCTTACGAACGTGCTCGGCCACAGTAG
CGCTCGAGTTGCTGGCGACCGATAGCCGTGTAGGAAGCGACTCCAGTGACTTGAGAATTGGGTGCTGCTGGATCTCCGCCTCAGCCACACCAAGCGCCTT
GGACACCACCGGAAGGAATTTGCCGTAGTGAGCAGTGCCAACGACGACAACCGCCGAGTCGGGCTTGTCGGCTAGCGCTTCCTGGCCGTAGTGCATGGCA
GAGGCCGCACCAATGGCGCTGTGCGGGTCGAAGAGGTAGCGGTGCACCTTCTTGTACTCGGCGATGGTGGAGCGGACTTCGTCTTGGAGCACCGCGTACG
ACGCCATCTCGTTCTGCGCCTTGGTGAGCAGCTCACCCGAGATCGTGAGCTCGCTGGTCTGCTCGAAACCCTGCATCCAGCCACGCAGCACGTCGTGGTT
CTCACCGGACAGCGCGAAGAGGTAGCGCTCGAAGTTGCTGGAGACGCAAATGTCCATAGAAGGCGAGATCGTGTGCTCGATGTTGCGGCGGTGGTACTTG
CCCGTGGAGAAGAAGCGGTGCAGGATGTCGTTCTCGTTGGTGGCCACAATCAGCTTGCCAATCGGCAAACCGAGCTTTTTTGCATAGAATCCGGCAAGGA
TGTCCCCAAAGTTGCCCGTGGGCACCGAGAACGCGACCTCGCCCGTCACGCCCTGCTCGCGAGCACGGAAGTAGGCCCAGACGTAGTACACAATCTGAGC
CAGGATGCGCGCAAAGTTGATGGAGTTGACGGCGCCCAGATGGTACTTGGCCTTGAAATCGGCGTTGGCGAATAGATCCTTGACGATCGCCTGGCAATCG
TCGAACGTGCCCTTGACAGCCACGTTGTGGATGTTCTCGTCCAGCACCGTGGTCATCTGGCGCTGCTGGATAGCGCTCACGCGTCCTTCCGGGAACAGGA
TAAACACCTCCACATTCTCCTTGCCGCGCAAGCCGTAGATGGCCGAGCTGCCGGTGTCGCCGGACGTGGCACCAACGACCGTGATCTGGTGCTTGGGGGC
GCCCGCGGGCAGCGCCTTGTTCTTGCGCTGCAAAAAGAACTCGAAGAGGTTGCCCAGGAACTGCAGCGCGATGTCCTTGAAGGCGAACGTGGGACCGTGG
AAGAGCTCGAGCACCAACAGCTGGTCTGTCACCTTGACCACGGGCGCCACGTCCTCGGCGCGGAACGTGGTCGCGTTGTAGCTCTTGGCCACGAGCGAGC
GAAGCTGGGCGCGCGAGATCTCGCTCTCGTTGATGAAGAGGCCCATGACCTCCACGGCCAGCTCCTGGTAGGAGAGCGACGCCCACTTGGTCAGCGCGTC
GGCCGGCAGCGTCGGGAATTCGTCGGCCTCGGGCACCAGCAGGCCGCGGTCGGCCGCCAGACCCGTGAGCACCGCCTGCTCAAAGCTGAGACCGCGGACG
CCGCCGCGCGTGCTGCGGTAGTGCACCATTGTGTGTTGGGTTGGGTTGGGTTCGGTTAGTGAGAGTAACGCGGCGAGAGCGCAAGTGACGCAGATGAAGC
CGCCTGCTTGGGCTCGGGAAACTTCTTGTGCACTGGAGGACGCAGGGCCCCGAAGTTTCGGGTAACATTTACCGTTGTTGCGCAAACATGCGACGTGGCG
CAGATGTTGCACGAGGTGTGGTGCACACCACTTACGGCAATGCTCATGAATTTATAGCTCAAGTTATTGCTGACCGCTACCGATTTACGTGTCTTGATCT
GCCATTTGACAAGGAAGGTATGAATACCATGGACACCTGCATTGCCTAATCGTGTCGGTTCGTCGGCTTCGCTCTCCAAGACATGCAGAAAAGAAGCCGG
CACATCTTCAACGAGAAACCGGGAGAGCAACAGCCTGCTGGATAATAAAAAAGCAAACAGGGAAATATATTTCGCATGAGTACTATCTCCCCGGGTGTTC
CACAGACTTCTCCTGCCGAGAGCTTTCTTTTCGTCCGCTACCTCATTGGAATCCGCCTTCCGTTACTCTCTACCTCATCGCTCGTGATCGCAATCAGTTC
TGGCCAAACTGGAACATGGTGGGCTCGTTAGAGGACGTGCCGAACTGGAACTGCTGTGCGTTAGCATCCGTGTCGGGCGCTAGGCTATCCTCCGCATCCT
CCTCGCCGTTGAAGAATGTTTCCACGATCTTCATAGACTTCAGGTAAATGTCTGTCATCGGCACGCAAAGCAGTTAGTAAGCATGCAAGGCCGGACGACT
CAAGGTAATAAATTACCTTCGTTGGCGTGGTACTGCAGCGCCTGAATCTTGTTCACACCGTCCGCCTCATCAATCATCGTTGCGATGTCGTTAACGTCGT
TGGTCTTCTGCGCCTCGCCCGCACGCAGAATGTTCTCAAGACCCTCCAGGGCCACAATCACGACCTTCGCGTCCTTCACTTCGAGCAGGTCGCACAGAGG
CTTGATGCATCCTGTACAAATCGACGACACAAGGTACTGTTAGGTACAGCAACCCAACTGCAAGTGTTCATTTCACTTACCGAGGCTGACGAGGTGCATG
ATCTGCTCCGCCGAACCTCCCGAAGTGGCGTTCGACACGGCCCACGCTGCCTCCTTACGAATGTCGAACTCAGCCGTTGACAGGAAGTTGATCAGGGACG
GGAAAATGTCGGCCTCGATGATGAACTGAATCTGCTCCTGGTTGCCAGCCGTAATGTTGGAAAGCGTCCAACACGCCTCCTTTCGGATTCCCTTCTTGGG
GCTCTCCAGAAGCGCACGCAGACACGGCAGCGCGTTCAGGTTAATAATCACCTGCGTCTGCAGATCGTCGCCCGTGACGATATTGCCGACCGTACGCAGA
GCAGGCGTCTGCACAGAAGGAGAGTGGTGCATCAGAAGCTCCACAATTCGCCGGCACACGCCAGCCTCAATCACCGCCTGAATCTTCTCGTTCGAGCCGT
CGGACAGGTACGACAGAGCCCAGCAAGCGTCCGTTAGCACTTCCTCGTCGTGGGTGTAGATGAGCTGGCCCAGAGTCGGGAGCGCAGGCGACACGAGATC
GAACTGCGGCTGCGGTTTGCCACGGCAGAAGTTCGACAGCGTCCACGTAGCGTTGCGGAGCATCGTCGGCTTCGAGTTCTCCCTGAGCTGCTGCATGAGC
GGACGCAGCGCACCGCAACGCAGCACCATGTCACGGCACTCGATGGAGTCACCGGCGATGTTACCAAGGGCCCACACGGCCTGCTCACGCACATCATCGT
TCGTGGACAGCAGCAGCTGGCAGAAAATAGGCACCGCGCCGTGGTTGATCACCACCTCAGTATCCGCAGAGGTACCCGAAGCAATGTTCGTCAAGCCCAG
GCCGCCTCGAACTGCAGGGTCGGGAAGTCCTCGCGCTGAAGGAACTGCACAAAAATGGGGACGACGCCAGTGTCGATCACCTCCTTAATAGGCGGGTTGC
GCTCTGCGATAACAGCGTAAACAGGTCAGTCAAGTCTTTTTTTGCCACCTCGCACTGTAGTCTCTAAAGCTCACCAATAGACAGCAGCTTGCGGAACTTG
GTCACCGCCTCGAGCTGCACGTCCGCGTCGCTGGACTGCACGCCCGTCACCATCTGCGGAAGCTCTGACAACTACACAACCCACCAAACGACTCACAAAT
CAGTGCGCGCCTTCTCACTTCGCGTCCAGCGCCTGCTTACCCGCTGCATTAGCGATAGCTCTCCGGCGGCGTCTCCCATACCAGTCGTCGCCGCAGATCC
GCTGTCCCCAGGCGTCTACATGGCAGCCACAACGAACAGTGAGTCTTCTCCAATAAGATACGAAAACGTCTCCAGGCTACGCCTGTGTCTTCTACTACAA
GGCCACAAGCCGATCGACAAGAGAATCCCTCTGCTTCTTTCGGTTGCTAAGCGTCTGCTACTGCTATGCGTACCATGCGGCGGCGCTGGTTCATGCGGTC
CTCCTTGATGGTCTTGCGGATCTGCACGGTGGTCTCCATGCGGCTGCGACGCGACTCATCCGAGTCGATGCCTTTCTTGAAGAAGTTCTTGCGCTCCGGC
GCTTTTCCGGCGGGGAACGACATGGTGCTCGGATCTGTGCGTGGGCGCGGCGGGCGGATCGGGACGCAACTAGCGACTGCGCGGCTTCTTTCCTTGTTTC
CCCTTCTCGAAAGCGCGCGGTACTGGCGTGGACCACACCTAGCTTTTTTATTGGCGGGCCTCGCACGACTTTTCGCAACGGAAATGATTGGCATATTTGG
CCGTGTCTATTCTTTTTAAAAGAAGCTATCATTACGATACGCAGAGCGGTAGTACACAGAACCTGCGAAAACGAATAGCCAACGTCACGGAGAGGGTCGG
ACCTTCAAGCCCCGATGATGAAGCCCTCAAGCAGACCGAAGCTGTTGCCCGCCACAGATGCGCCCACATCGTCGTCCTCCTCCACACGCAGCGTGGTGAT
CCACGTGTTCGACGAGTACCGCAAGAGCAGCAAGGAATTCCAGTGCCAGCGCGACCTGCTGCTGGCCAAGATGAAGTACTTCCAGGCGTACCTGAACGAG
GCCAACGAGCACGACGAGATCGACATCTCGGTGCACTGCGACGTCGAGATCTTCGAGCTGCTCATGGAATACATGCACCAGCGCGACCACGAGTGGCGGC
CGCGCATCACGCTGGAAAACATCGCGTCCATCCTTGTCTCGTCCGAGTTCCTGCAGATGGAGGAGCTCGTGGAGGAGTGCGTGGCTTTCATCTCCAGCCG
CGTGCAGGACTTCATGCTACTGCGCGTGGACTTTGGCTGCCTGTCCGACACCACAATCGCCAAGATCGCTAACAACTGCACGCCCGAGCAGCTCCAGACG
CTGCACGACCCCAAGGACAAGATCCTGTCCAAGCTGCGGCGAAAAAAGGTTGAAGTGCTGGTGAAGACGCTGCAGCACAGCGGGCGTCGCATCGAGCTGT
GTACGCACTGTGAGCTGCTATTCATTAGGGACGATAGGGGTGTCTAGGATGCCAAAAGGGTAAGCGCCAGATCGGCGTGCATGGCGAGCTGGTCGGAAAG
CACCAAGCGAAAGCAGGGTGGCAGGTCGAACTATTCCTACGCGAGCTTGGCATCGTCAAGAGTATTTCGTGGAGCGCGGTTTATTGGTACATCTGGGGCT
CTACCAAGTACTTCCACTGCAGCGTCTGCAAGCAGAGGTGCAGCTTGCTTGAGCTGCGTAAGTGCGCCTATCACCCAGGCTCGATCGTCGATTACGGCCC
CGCTGCCAAGTTTTCCTGCTGCAGCGCGAGGATTTTCAGCGCCGACGAGATATCAATGCGCGGATGCAAGGCCATTGCCCACGTTCCGGTTCAAGGCGCC
GATAAGCACGCAGACGTTCGCAGCTTCAGCAACGTCGTGGCGCTTCCCAACATGTGGGAGCAAATCCACGCGTGTGAGAAGGTAGCGACGGCCCAAGGCC
CTCCACCTATCGGAGACGCAGGCGGCGGCGGAAGAGTTGACGTTGCCTTGCTCTTTCCTCCGCCTCAGCCGAGGAAAAATAGCTCAAATGCTGTGGAGCG
TGAGCCATCGTCCAGAAAGCTGAACTGTGCAGGCGAATGCAACTCGTTGGGCTACAGGAAGCAATGCAAGGTGCTGCAGCTGCAGGAGAAGGATCGAATT
CGCTGCCAGGACATCGCGCGGCAGCTGGTGCAGCAGCGCCTAAGGAAATCTCGTCTCTTGGACCTATAGCGCCCGCAACCGCGATGAAGGCAACACCGCT
TGGGCTCGACGGGGTTAAAAGAGGATGTTCTTGGCCCTGTTGAGGTATCGGTCCACTACCGCGCCGCATAACGCGCACTTGTACACCTCGCTGCAGTGAG
TAAAACTAGCGGCCTCTCCATGGTGGTTGGCACGTGCACCCCCAGGTTGCGGCGGCGGCAATCTCCTGTTGCCAGGAGCGGAAAAAGGCAACTCGCATTG
TACCCCGTTACGGGTACACCGCTACACTGCTCCTGTAGAATCAGAACGGAATCAGCTCGGTATGATAAGCGGTTGGCAGTTGGCAGCCTGAGCAGCGATG
TGGAAGCGACCGCTGCGCGACGTGGTGGTGCGCTGCCATGTGGGCAACTTGCGCGTGTCTGGGGTGATGGCACGCAACGCAGTCGACGAGGTGGCACGAC
GGTGGCGACTGCCGCTTTCCTCCGAAGGGACGAAGCTCTGGGGAGAGTACATGGCCGGCACCACCATGCTCAGTTCCTTTTTCAAGGGCGAGGAGCGCGT
TAAGATGATGGTCAAGACGCCCAACATCCAGGAGCTCTACGTCGAGGCCATGGCCGTTGGAGAGGTGCGCCCCCACAGTATTATTGAATGGCATAGCAGT
GTGCAGTAGCTCAACGACGTGCTCATTGGTTGGTTAGGTCCGAGGCAAGGCTATCTACGTCGACCAGTCTCTCGCTGGCGCGCTGGAAACGGGAGGGCAC
ATGCACGTCTCTAAGATTTTGTACGGCGCGGCCAAGCCGTACAACACTTCTATCGAGGCGTCCGGAATGCCGGAGCTGGACTGGCAGAGATTTTTCGACG
TGTCAGAGCAGGTCCCGACCATTGTGCGTATCGATAGCGAAGCTGCCGACGACCACACACGTAGCTGCGGACTCATCGTCCAGAAAATGCCGCCGACAGA
GGCGCATGAGCGCCATTACGAACTAGAAGAACTGGCCTTTGACAAGCTCCCCTTCTTCGCTTCTGAGTTGAAGAAGAATACGGATCTGGTCGAGTACCTG
AACGAATTGATTCCAGGCGCCGATATCACGGACAAGAACTGCAAGCGCATGCCACTGGATTACTATTGTCGCTGCTCCAAGGACAACTACGCGCAACGAC
TCAAGGACATGGGCGCAACAGACTTGAAGCAGATTGCAGCGGACGTGGGCAGCGCTGGCGTCGATCTCACCTGCCATTTTTGCAATGACGCATACCACTT
TTCTTCTGGCGAACTGGAAGGTCTGATCGAGTCGCTGCCGAAGGCATAATCAAATACGCTAAAGCAACGAGGTAGTATATCGACATGGTTATAGAATATG
ACGAAGTCATCATCTATGCGTTTGCCTAGCCCTCCTGTCCGAACTCCTGGGTCCACTTCACGAATTGGCTGAGCTCGTCCGAAGCAACAGTAGCGGTAGA
ATGCTCCAGCACGCGTGTAAAGTCACTCTGCAGTTGAAAACAAGACGACACGAGTGAGTCAAATACTAATCAAGACCACATCCAGAGCGAAGCAGACCCT
TACCATTGAGATCATCGGCGGCCGCAGCTTTTCATCGGAGTAGCCCCGTTCTGGCAAATCGTACAGACGCATGCGTAGCGCACCACAACGTCGACATGGT
GCCTTGCAGTCCGGACACTTCGGACGGCACGTAGAAAGCTTCATGTGACAGTATGCGCACGGTGGGTCACCTTCACAGGGTGTCAAGAACGGACCGTTCC
GAACGGGGTGTGCCTTATCATTGCACTGCAAGTAATGAGATTTTTGATGCTGTCAGTAAACATTCACACCAAAATCGGATGAGTTACCGCATCCTTACCG
GAGTAAAGAATTGGGCTTGTTGGCACTTCCGGAGGGGCTCCATTAACGCATCTCGAACAAGCACCGAGATATCTGAACCAGAGCAACTAAGAAGATGCAA
AACAAATACAGCAACTAATATCAGCTCGATGTTCCAAAAAACACCTTGGTGTTGCAACGTACCCGTCTGTTTTTTCCGCAATGGCAGTGAAGTTTGAATC
GCTTAGCTCATTCGGAGTATCGCCCAGGTGGATTCCTAGCATGACCTTGCGTGCATCCGTGTCAGGAAGAGGGATGTAAATGCGCTTCTCAAATCTGCAG
ACAAAAGTTCAATGTCAGCTATCCGCAAACAGATGCCTGTGCTTCCTTCAAACAATCATATAAAGTAGTACGGATTTACCGTCGTCGCATGGCTGGATCA
AGCTCCCAGGGTACGTTCGTTGCCCCGAGCACCAGGACACCGTCATGATTGTTGCCCATACCCTGCATTTGTACGAGGAACTCATTCTTGATGCGACGCG
TAGAGTCACTCTCGCCCTCGGATCTGCTCGAGCACAGCGAGTCGATTTCGTCTATGAAAATGATAGCGGGTTTCTTCTCGCGCGCCATCTCGAAGAGGTT
CTTGACAAGCCTGCACGACAGCGCATACATCTTATTTCAGCTACAGCAGCTCAAATTCGAGTTTCATCACGCCAATGCGAATCATACTTTTCGCTCTCGC
CTTGCCACTTGGAGACCAGACTGGAGGATGAGACGGCGAAGAACGTGGCGTCTGCTTCCGTTGCGACCGCCTGTGCAAGGTACGATTTGCCTGTACCCGG
CGGCTACATCAATAAACAGCTTAGTGTACACCATGCTTCCCGACTTTTACGGCAATCACTCAAGAGCGCACCCCATATAGCAGAATGCCCTTCCAAGGAC
GGCGCTTGCCCGTGAACAGCTGGGGGAACCGTGCAGGCAGAATCACTGCCTCTTTCAGCGCCTCCTTCGCAGCATCCAGTCCAGCAACGTCGTCCCATTT
CACATTAGGCTTCTCCGTCACAACCGCCGCTGCACAGAATCGTTCAGAATGTGCACATCAGCCACAGCAAACATGAAGAACCCATACTCGGAATCCTGAG
TTACTCACAAGCCAGGGAACCACGTAACTTGGCTGTCTCTGCGTCCGTCTCATCGTCGTCTTCCTTCTCCCCCCTATACACAGCAGCAACCTCAGTATCA
AAACAGCACCAGCACAACTTGCACGGCAAACAAACGTACTTGTCCATGTCCACGGCGGCGGCCACCGCCTTGGGCGCGTTATCCTTCTCCAGCATCCCCC
GTAGCTGCTCCGCCCGCGTCATGTAGCCCTCCACCCGCTTCATGATGATCTCCTTGATGTCGGATTCTTCTCGTCTGCAGGGCAAGAGTCAAGTTAGCTG
CATTGCAACATTGGAAGTCGGTACCCGTACGCCTCCTCGCTGGAGCTTCAGACGTACATTTGACGCCGACCATGAAGTGCTCGAGTGCCTTCTTGTACAG
GCGGAAGGCCTCCTGGTAGTTTTGCTGTTGTCCTCATTGATGGCGTGCGTCACGATCTCGATCGCCTGCGGGATGAACTTGTTCTCCATCGCGGCACCAC
CTGATCAATGCGGCGCAAACTCAAGTGTAACATGTAAGAAAATCCACGCGACATACCATAAGCCAAATTCCGTTTGTTTGACATATCATAGGCCAAATTC
TAAAGAAAAATCGCAAACTGATTTTTCCGATACAATATCTCTGTTGGATTATCCAACAAGATCGGATGAAAGATATCTCCATGTAAAGGGTCATCCTGCT
GCTTCTGGCTGCAATGGGCGTGAGCCAGTCGAAGGGCAGTGGCGCGTGGGGGTGCGTTGGAAGCTGCAAACGCTGGTGCCTCGGTCGTGGGGGGAGCTGG
AGCAGCTGCATCTGCGTTTCCAGCAGGAGGCCCACCGCCGTCGAGCCGACCCCGTGTTCCAGTACTTCCTGCCGTTTCCAGTGTTCCAAACTATCGTGGC
GCCGCTGTGCCCCGACAAGGACAAGTTGCATCTGCTTGCCATGTTCGAGGCACTAGATGTCAAGACGACGAGGAAACTGGCCGTGATGGACTTCTTCAGT
GGGCTGGCGCTCTTGGTGGATGCCAAGAAGCCTCAGAAACTCGAGTGTGAGGCGATGCACCGGGCGGTCTAAAGCACTAGTCCTAGTGAGGGTAGCTAAC
TCGTACGCGTGGCTCCAGTTGTGCTGTCACTGCTGGACAACGGAGGCCTGAAAACGCTCAACAAATGCGAGTTGACGATGGTCGTGTCTGCAGCGGCCAG
GGGATTGAAGATGTTCGCGCCTGAAGCAGACGTCTTGCAGGAATCAACCATGAGGCCGCTTATTCGCCGTAAGGACTGCGGCTATGATTTATGCACCTGT
GTCAGCTTAGCGTGTCTGCTTTGCTGCAGGTCTGTTCGGAGACAGCAGCGAGGTTCTGCGGCAAACCATCGTCAATAAAGCTCTCGCAGACCCTGAAATC
CTATTTTTCATGAGCGATCTCGAGTCGGTAAGTGTCTATAGTTTGTAAGCTTGCTCAATAGCGCTTGCTTGGATTTTATTTGTCTGTACTGCATGCACAA
TAGGGTGTAGCGACGTCCTCCGATGAGTTGCTGATTCAACAGGGAAAGCTCATGAGGCATATGGCCTACTTGGACTATCAAGCCGCACGCGTTAAAGCGT
CAGGTATTGCAATATTCTTGAATGTATACGTCAATGGAGTCCAGCTCATCTTTTTTGTCATTGTAAGAGGAGCGAGGAAGGACAGCAGCGGCAACTGCTC
CCATGAGTGGAGTCGGTGAAGAAGCCAAGGGCCAGCAAGCCCTGACAGTGACATTGGTCCCCACAGCAGAAAGTTTTTCGCGCAGACTTCAGAGTATTGT
GTGCCCACCCCCACCAAATGGGTCAGACCAGTCAATGCGCGTGCTATCTGCAGTTGAAATTAAGAAGCATGTTGACCCACGCACACTCCAGCGGTTGGTC
AATATTGTTTCAGATGGCGGTCTATCGCTCTCATGGAAAGAGGTTGATTTGCACGGCAAGTATCCTACCTTCATCGAAAATACTGATTTATGCATTGCTT
GTCCCCCTTCAGGCTGAAGCACTCTTGGGCGATATGACTTCAGACCAGTTTGGGCTTGTACGGTGCGGCGACATTCTGCGCGTCATGAAAGCTTGGGTAC
AGAATCGACGACGAGAGAAACCAGAAGCACTGTGGGAGTTTGTGAGCAGCTACGTGGCTGACGGTGTTAAAAGCATCGAGAAGCAAATGAATGCTGTTCT
TGTTGCGATTGTCAAAAGAGCAACGAAGGCGCTGGGGCCTACTGTGCGTCAGCGGACGGCTGTAGCTAAAGAGCATTTGCTTGAAAGCTTGCAGAGCGTC
GCACTAAACCCTGATACTGACGATGGGGAGCTTCAGTGGAGTCTCAGCATTCGAGTTGGCGAGACTGGTCTGTCGGTGCTAGCGCCAACAAGCTCTCCGC
CTTCGAAGCGTCTAGGCGCTCCTTTAGGAAATAACATCAGATTTCGACTAGGGATTCATCCACCGAGTAGTGCAGATGGTGATATCGGTGCTAAGGCCAA
GTTCGAAAACGAAGGGCAAGCGAACAACGACAGTGACGAGCTAAAGGATATTGATTCGGAAACTATGCGCCTTTTTGCCAACTTCTTACTAAACCCCGAA
ATCACAGGTAAGGACCGCCATCTTGATTGCGCTGTGTTTTTTTTAAACCCAAGTTCTATGCTTGATTAGATGAAGAAGGCATCAACTTAGCATCATCGGT
AGAGAAGGCATTGCAGCAGGAGCTGGTCTGGTCATCATTTGCATCTCTATGGACGAAATGCTCGGGTTCGGACTTACGATACGGAACTGTGACGGGGCTA
TGATGTGGGCTAACCTACTTGTATTTTGTATAATTGTTGTAGTTACAATGCATTCGGCAATTCGAAGTGACAGAGGAGGACAGCCTGTCCTTGACCAGTA
TCTTCGCGTCTGTATCAACTTCCGCGAGGACTTTATCTCGAGTGTGGAGGTAAGCTACCGCGCTGATAAGCGTGAGCAGACAACGTTTTGGGCGTTGATA
TTCACGTTATATTCATTGCGCAGGAGTGCACAGGTACATCGTTCGCGGTTGGAATTCGTAGCTTCTTTCTCTTGGTTGAACTGGAGCAATCTTTGGTGGA
TATTGTTGAGGCTTCACTGGATATGTCTGCGATGCTTCACAGTCTTGGCAAAAGGCAGAATCGACAACGCGCGATGAGGATGATTTTTGATGCATTTGAT
GCAAACCATAGCGGCGAGTGGAGCCTTCAAGAGTTCAACACTTTCCAGCAAGCACTTGGAAAGGAAGCTCTGCTTGAAATCACCCTAGCGGAGTTGTTTG
GCGGATCCTCGTCGATTTCATTCGACCAGTTTGTTACAATCTACGAAAATTACCCAATCGCCAAACTACTCGAGATGATCCGTCAGCTAGAAATTGGTAG
GGGTACCTATTCGTGGTGGAACGTTATGGATTGCTGTACTCATGACGATATTGCTGCAGGCTCGCTTGGCAACATGATAAAGGGTTCCGTATCAATAACA
TCGACACTGAATGAACCATGCGTAAAGGCTCTGGGCGTGTTTCTAAGCCCGCTGCGCTGGGCTGACGCGATGTGGAAAAGCTGCTTCATTTCTCTAGAAG
CACGAAGGATTTAAACCTCGAGCTTCAGTTTTCCACGCTTTCGGATCTCCTACAGAAGAGCTCTCGTCGTGTCGGAAAGCTGGATTGTATCGGGGACCCA
CTGTTTGTAGCATCATGGATGAACTGTCTGGAGGAATTTGTGCAGCCACCACATGCAGAGCACTTAAAGGATCGACCATGTCGAAGTATCTTCTGTTCGC
TGGAGAGTGAGATAAACAAGACGGAGCAGCAATGGGAATTTGAGGACCAGAGTCGGAAGCTTCCACGGGGTACATCTGCTCGCCGTGCCGAAGCCATGAT
TCCAATTCTGGAAATGGCAAAGCTTGTAAAAGTGCACGTTAAAGGACTAGTATTGTTGGAAATGCGTAGCAAGAGCATTCGGATTGTGTGCGAACTTGAC
AACCTCTGGATGGCGCGGCCAAGCAACAATAATGAAGAAGTCGACACTGGAAGAAGTTGACCTTGGGTAACGCTACTTTTATATTTGCGAGGTAATAATA
GGTCATTTTAGTTACGTGTCGACGTGCTCAAGGCGAGAGCGATATGATTCAAAGAATACTTGACCTCGCTTGACCCATGAATCGTCCAGTGACGGCGACA
TCAGCTCACAATGATGAGGGGGGCTTGACATTTTCAAGCGAAGAGTCCAAAACTGCGTATGCCCAAGCACTTGAAAACCGGCATCGTGGATTGTACCAAG
AGGCCGTCCGAACTGGAACAGATCATCGAGGTAAGTGTGACAACGCTCGGCCCACGAAGAGTGGCGTACTAACACGTATTTGCTGGCAGCAAGAAGGCGA
CTCCGAGAAGCTCTGGACTGAGCTCGCACTTGCACAATTCCAGCTTTGGGAAGCGCATGTCCGAGCATTACACTTGCCGTCCATTCTAGTGCTCACATCA
GCAACGCAATCCAAACGACCCACAAGCGCCAGAACCGACACCAAGCCATTGCACATGGTGCTGCTTCAAGAAGTCTACAGCACCTTCCTCATCGCGATGG
AATATCCAAACAGCAAATCAAGCCCAGAGCTGTTGCTCCCACTGGTGCGGCTTTACATCGAGTTTGGGTCGCATCGGGGTGCACTCGCCGTCTGTACACT
GCTGGTCGAAGGATATTCAACGTCTCCACGCCTCAATGAGGCCATTTTCTTGTCGGCACTTACAGCATCGGCACTGGGGCGCCACCGTGAGAGCGCACAA
TATTTCCAATACCTAGCGGAGGGGCCGGGGCCGTCGTCATCGTTCCCGTATCGCCTTGCTGGCTATCAACTGAGCCTGCTAGCAGCATTAGAGCTAGCCC
GGGTGCCAGGTATGCGCGCACTGGAGCGTGAGATGTATACCCAAGCGTACAAAGCTTTGGTTGTGCTTCCACCAGTACTGCCATCGGAGAAGACAGCCCA
CACGTTGTATACGACATCGAGAAAAAATGAGGAGCAGCGAACCTTACTATGGTGTCGCGACGTGCAAACATGGTTAGACCTTGCTCAGAGACTTGCTGGA
CCAGCCAATGCTCCGCTTCTCGTTCTATTGGCAATTCGTGAAGCGCGGCGCCGGTCAACAGGAGAACAGGATCTTTCCTACATCAAAGCTGCTACTGGAA
GGCGTTAGTCTGTTGAGGACGAGAGACAGCTTGGGTGCCGAGAGGGTACTTGGTGAAGCGATTTTGCTGCTACCTCGTGATACATACTACAGCGCGCGGC
ACGAACGCTTTTTACTGGAGCTATGCAGTGCCTCCTGGCGTGCACAATTCGCCTTGGAGCACAAGAGTGCTGCACGTCTACAAGTATTGCATCGGCGCCG
CCGTAAATTAGCGCAGTGGCATCTTGCTGTCGCTCATGTTCTGGAGCAGCGTCGCATGCCATGACGTTGCGCATTCAATGCGCATGGCGGGGTTCACAGC
AAGACAGGAGCTTGCATCCTTGCGTCGAAAGCAGCAGAGAAGGAAGCGCTGGCTAATATGACCATGGGTGTGCACGACGACAGACTCATCGAGCTACGAC
TGAATGCAGCCGCAAGGAAAATTCAATCTCTGCTTCACATCGCGCGAGCAAAGAGGACGATTCGAGTCCTGCGAGCCCAGAAAATCGAGCGACAAGCTCT
CCTGGCAAAGTTTGCTGGTCGCCGGACCGAACTCGGTCAGCTTGGTGTATTTCGTAGATGGCGAAGCTTTGCTTCAACCCAGAAGCAAGAACGCCTTGAT
GCGGTCGTACGAATTCAGCGCCAGGTTCGAGCCTGGCGCAGCCGCAAACTCTGTTTTCAGTTGATATTGCTTCGACAGCAGCAAAATAGTGTTTTGCAGC
AGTGCCTGGCACGGCGCTCGACTTCGCTCATTTCACGCGTGCTGAAAGCCTGGCACACGGTGCTTATCGAAGCTAAGAGTGAGCGAAACTGGGCTTCACG
GCTGATTCAACGCAGATATCGTTCAAGGCTAGCAGTACGCCAATATCATGTTGAGCTGCGGCGGCACCGAGCAGCAACCACCACCATGAATCGTATGCTT
TTAAGTCGCACGCAGCAAAAGCTTTTAAGCTCATGGCGAGCCCTCGCAAACCACGCGCTAATCCGTCGTCTGCGCAAGCGCGGAGCTGCTGTGACTATCC
AGAAACACATTCGAGGCGCACTTGCCCGGCGACAAGCCAAGCGCCTTCGTGCACGTCGCCGCCGAGCACTCAAAGTGCTCGTAAAGCTCACACGCTCGCG
CGAAATACAGCTTCAACAGACAGGATTCGATCGGCTTTGTCTACATGTGCAAGAGCACCACAGAAGAGCACATGGCGCAGTGGTATGCATACAGGGGCTC
ATTCGGGGATTCTGCTGCCGTCAAAGGCTCCATCGACGGCGTACGGCGGAGATGCTGGTTCAAGGGAGCGTCTTCGGCAGCGCGCTTAAAGGGCAGCCAG
CAGACGTCGTGCTATGGGCATGCTTGATGGCGCTGTCGCGATATATTCGACAACGAGATGCCGCAGTCGTTCGGCTGCAACGATGGTGGAAACAGCGGCA
AAAGCGTGCTCGAATGATCCGAGTATTGAGCAAGCGTGCAGCTCAGCGTCACCTACTCGGCAAACTGCAGCAGAGTTTCTACACAACTGCAAGGAGCTTC
CTCCGGGCGCTTCAGACTGCTATCAACACCAAAAAGGCCCGAAAGCACTCGGCAGCGACTAAAATCCAACGACGGCTACGATGCTGGGTGATGCGCCGAA
GGTACCTTAGTACTCTTGATAAACACTCAGTCGCTGCTCAACGTGGTGAGAAAGCAGCAAGAAAAATAGCGCTCCAAAGAGTACGCCGCTTGTATCATGG
CTGGCGGGATGCAACGCGGAAGACGCGACAAGAGCAGCACGAGGCAGCTTGTCTGGTACAGCGAACTTTCCGGCGGCACCGAGCGCAGCGGCAGGCACGT
TGTGTTGTGGCAAAAAAAGCAGCACAAGCACGATTGCTGGCTGCAGCCTCACAAAAACCGTTGGAGCGCTGCTTTCGTCAATGGGAGGCCACAGCCCTGC
TCGAAAAGAGTGTGCTGCGTGTGCGCAGTTCGTCACTCATCGGCTCAAGAGAAAGCACCCCCGTGAGCGGCCAGCGCAAGCTCGAGATTTCTTCTGGTGG
TAGGTTCGACAAGACTCCGACGCTTGAGGAGGTAAGCTGTTGGCTGAGCTCTACAAACGTGCAGCGTACGCTAACCCACCAATGTCTCGTGCTCAGCGCG
CCAAGATACCGTCGATGCTCTTTTTCACGGTACTCAACCGTGTGCGTCAGACCGGGATTTGTCAGCTCTCTTACAGGTACGCCTTGTCGAGTGCACTGCT
GTTCACACAGGCAAAAACTCACTGCTCACAATGTTTTGAATTTTCCAAGCGGCGGCACCGTGTTCAAGGGTCCTCAACTGCGGCAGTTGATCTCATTGTC
CACCAGCATAATCGTCGACAGCGGTGGCGGTCTCTCCCAGCCTCCTGCAGCTCTCTTCTCAATCTCAACGAGCAGGTCGTGGAAGCTCTGGAGGTGTGCT
CCAACTCTGGCTCGGGCTGTCCAGTTCAATCGCTCATCTTGTGCAATGCGCCGCTCCGGTCCCCCACGCGTCCCTGCTAGCCACTGTATTGCAGCGCAGT
CGCAAAAGTTCCAACCTCGCTCTGGTTCCGTGGTGCTTGCCAACGTCCCTCTCGCGCTCACGTCCGTTGTCTCTCTCGCCTGTGCAAAGCCCGAGCTGTC
TGCAGCAACTGGTGCTCGAGCGCTGCCAAGTGGGCAGCGCCGGGGCATCAGCTTTGTTCGAGGCGCTGACTACAATCGCGCGCTCTGGAAGCTCGATCTC
AGCGGGAACCACATTGGAGACGCCGCGTGTCCCGCTCTGGCCCGCTCCCTCCTCGCTGGCAGTGCAGTGCGCGTGCTGCGCTCAGCCGCAACTCGCTGTC
CGACCGGGGTGTACTGGGCTACCTGTCTCCCGCATTGGGATCATCACGATTGGAGACGCTCGTGTTGCTGCAGAACCCGCGGTGTCGTCTCTGGCAGCGC
GTCGCTGCATCAAGCTGCTGCGTCCTCTGGAGATCTTATTCGCGTCCTTTCGGACGGCGGGTTGTGAGAGATATGGCTACATGTAGCCATGTTGTCACCA
AGAGCGTGCTGATTGGCTGAAGGCTGGCTGGACGGAGAGCACCCTCGGTACCCTGTACGTCAGTGGATGGTTCAGCAGAACCGAACACTCCGAAGCCTCC
ACCCGACTCGTAGCACCATGGTCGACGCCTCCCACCACCGCAAGCAGGTGGCCATCCTGGACTTCGGCTCGCAGTATAGCCACCTGATTGCACGCCGCGT
GCGCGAGCTGCACGTGTTCTGCGAGCTCTACTCGTGCCTCGTGAGCGCCGAGGAGCTGCGCAAGCACCAGCTGACGGGCATCATCCTCTCGGGCGGCCCG
CAGTCCGTCTTCGATGAGGGCGCGCCCCACGTGGCTCCTGAGGTGTGGCAGCTCATTGAGGAGCAGAAGATCCCGGTGCTCGGCATCTGCTACGGTCTCC
AGGAGCTGGCTTTCACCTACAACGGCAAGGTCGCGCCGCAGCGAGTACGGCAAGGCCATCGTCAGCCGCAAGAACGGTGTGGACTGCGGTGGCCTGTTCG
AGGGCCTGCCCGACGAGTTCCAGATGTGGATGAGCCACGGCGACAAGCTGCACGCGCGCCCCGACGGCTTCGTGGACATCGCCACCACCGAGAACTCGGA
GCACGCCGCCATCGTCAACGTGGAGCGTAAGTTCTACGGCATCCAGTTCCACCCTGAGGTGACCCACAGCCCGCGCGGCAAGGACATTTTGCGCAACTTC
GTGGTGACCATTTGCAACTCCCCCACGGACTGGGACATGCGCAGCATCGCCGACGCCTTCATCGAGGAGGTGCGCGAGACCGTCGGCCCCGACGGACACG
TCATCGGCGCTGTGAGTGGCGGTGTGGACTCGTCTGTCGCTGCCGTGCTGCTGCAGCGCGCTCTGGGTGACCGCTTCCACGCGGTGCTCATTGACAACGG
TCTCCTGCGTAAGGACGAGGCCACCGAGGTCGTTGACCGTCTGCAGACCAAGCTGGGCATCAACCTCAAGTGCATCGACGCCTCAGACCGCTTCCTGGCG
GCCCTCAAGGGTGTCACGGAGCCCGAGACCAAGCGTAAAACGATCGGCAACCTGTTCATTGAGCTGTTCCAGGAGGAGGCCGAGCGCATCGGACACCCGG
TGGACTTCCTGCTGCAAGGCACGCTGTACCCGGACGTGATTGAGAGCGTCTCGTACAAGGGCCCCTCGGCCACGATCAAGACGCACCACAACGTTGGTGG
CCTGCCTGATACGATGCACCTGAAGCTGATTGAGCCGCTGCGTGAGCTGTTCAAGGACGAGGTGCGTGAGCTCGGTATGGCTCTTGGCATTGACGAGCCC
AGCGTGTGGCGCCACCCGTTCCCTGGCCCCGGCCTTGCCATCCGTGTGCTCGGCGAGATTACGCCCGAGGCTCTGGAGACTCTGCGTCACGCTGACTCGA
TCTTCATTGAGGAGCTGCGCAACAGCGACCACTACAAGACGACGGGCCAGGCTTTCTGTGTCCTGCTGCCGGTCAAGTCTGTCGGCGTCATGGGCGACGG
CCGCACGTACGAGAAGGTTGTCGCCATCCGTGCCGTCAGCACGTCGGACTACATGACGGCCGACTGGTACCACATGCCGTACGAGGTGCTCGGCCGCATG
TCGAACCGCATCATTAACGAGGTGCGTGGCGTGAACCGCGTCGTGTACGACATCTCGTCCAAGCCGCCTGCCACCATCGAATGGGAGTAAGCGGTATGGT
GCACTCCTCGTCTTTGCCACCATTTCTGCAGCTCCGCTCTACAGGGTTACTAGGAATACTACCGGTAGGCAACGGCGGAGGAAGACACTACCCCTTACGG
TAACGTCGCGCTAATAGAGCAACGATACATGCGTGTACACTAACCAAGATCAAATGGAGCAAAGCGGCAGGCACGCTGCCCGTTCATTTTCATGAAGTGC
TGCGACTTAAGCGACAAGAATTCTTGGCTTCAACCGGTCAGTAGTAACGGACGTCAATTGCTCATTGAAGACGTCGCTCCAGGATGCTGGCCCTCAGCGC
GTACGAAACACTGAGTGTGCTCGGCAGTGGACAATTCGGCAATGTGGTGCTCGTTCGGCGCAATTCAGATCGGAAGCTCTTTGCGGCAAAAGTTCCCACG
GCGAGGACACCGCAGCGAGGTTGGCTGCTCGTCAGGAGGCTCAGCTACTTATGCAGTTGCATCATGCGAACATTGTACAATTCATCGAAGTGGTTGAGGA
GGATTCGCAGATAGCACTGGTGATGGAGTATACTAGCGGCGGAGACCTGGATACCTTCTTGCGATGGCAACAAGAAAGCACGTAAGCTCGCGAACTCATC
TGCTTGAAGCATTTTCATTTTCACAACCGTTGATGTTGCTCGTAGGGGATTTCTGAGCGAGCCTGCAATCATGCGCATATTCATCCAGGTTGTCCTTGCG
CTCCAACACTTGCACGAACACCGCATTCTGCACCGGTACGCAAGCTTAAAAGAATACTGCTCAGATGCCAACGTGTAGAGCGACCCACTCACGGCTATAA
GTGCCTTGTTGTACATGTAGAGACCTCAAACCGAAGGTACATGGCTTTAGCTCGGGAGCCGGTTATCGTGAACTACTTACCTACATGCGCGAACGGTTCT
TGCTAGAACATCCTACTGGATGGCGACGGGATCGTAAAGTTGAGCGATTTCGGCGTCTCGACGGTTTTGCAAAGCTCTGTGGACTCTGCTCAAACCATCA
CTGGAACCCCACATTACATGTAAGCTACAATCGTTGTGCTTCTTGGTCTAGGGTATTGTTCTCATGATGCTCGATCTCAAGGTCACCCGAAATTCTCGAC
GGAGATTCTTACGACTGCAAAAGTGACGTCTGGAGCCTTGGCTGTGTGCTATATGAGCTGGCAACCTTTTCCCCACCGTTCACTGGCTCAGCCCTTGGCG
CGGTTGTGGGTCAGATTCTAAACTGCGACCCACCGCCAATCCCTTTGTGTTATACTCCACCATTTCGAGCTCTCGCAAGCAAACTACTCGAAAAAGACCC
CCGTGTACGCGACAAATGTATCTGATGGATGCAGCAACACTTCTAAAGCAATGTGTGTGAAATATGACAGCGGCGACCAGGTTTGCCAGAAATCCTGACT
TGCCAAGCTGTTCAGCACTCCATGATGCAGCTAGTGAGCGTTGCTACTTCGCATCAGCCCATGCTCCTGGAGCAGTTTGCTGCAAAAAAGAAAGACTGCA
AAGCTTCACAGCAAGATGAGATTACTCTTTCAGAGGTGGTAACTCCACTTCCCAGTCGTCAGGGCCTTGGTAGTGCACATCAAAACAGTGACCAAGCCAA
AGGGTTCATACGTAAAATTCAGCCGGAGACAAACGATGCTCGTCAGGTTTTCTTCGAGAACCAGGTACGATGCACTTCGAAGTACAATGCAATGAGCCAT
ACGAATCTAACGCGCATCATCCTCCAGGCAGCTGCTCGAAAAAACAAAGAGCGCATCGTCCAAGAGAGATCATGTCCAGCAGTTTTCCTTGACTGCAACG
ATTGTAATTCGCCAGATCACCACACTCAAGTCCAGGCGCAGATACAGAAGCCCAGCCTCATCAACAGCCCCAGTGGCCGACAGATACTAGAAAGTTTTGG
GTGTTCTGTTGCAGTAAGCAAGCCCGATATGCCGCCCGCACCTTCGTCTTTAGCTTCTGTCAGAGGTCGAGCTCAGTCGTCACCGTACGTTGTTACCATA
GCTGGATCGCCGAACATTGAAACTAACACTAATCCTTTCAGCTCAAACTACGAAGATCTACTAAATAATGAGCGACGACGCGTGCAGCTCGAGACCAAGG
CGTTGCAAGAGCGAATGCGAGTCATGCAGGCCACAGACTGAAAAAACTTCGACTTTTGCGGATCAAAGCTGTGGAGTAGCATTTAGAGTGGAAGCCTGGA
AAGAGAAGGCCAAAAAGAATGGATTATCTACTGTGGTGCTGGGCTTGAACGACTGTTGGAACCGATCACTACAGTTTTGCAAAACTTTTGCCGATCATTA
CTCAGAATGCATACATACATGTATCGTGGGCTTCGAGAATCTGCAACCTCTCTACTGATCTTCAATTGCTTGCTGCATTGGGCCCTTCATTTCGTTGCGA
TCCAACGCTATTAGTTGTGAATTCATTTGTTGGGGGTAATGTTTCTTTTCGAGTCCGAAATATACTACCCGGTAGTCATGAATAATGCTCGGTGTTGAGA
TTCTCATCCCCATCAAAGCACCATGAAGGCTAACCAGTTCGTCGAGTTCGGGTGCGTCCCAGCGCCGTCGATGCTTCAACTCACTCCATAATCTGTCCCC
CCTACTAAATGATCCAATATCCCCACCTCCTACAGCAAAAAGATCGTGGCCATCGGAAAGAACTACGAGGCCCACGCGCGCGAAATGGGTGCGGCCTCGG
CCCCCAAAGACCCCGTTCTCTTCCTCAAACCCACCACCAGGTACAGCAACAGTCGGCAATGAAATCTCGCGAAGGAATCGCTGAATTCTGTGACTTGTGT
GGGTAGCTACGTGCGCAATGGCGGCAGCGTGTTGCTCCCCCCTGGAATCGGCGAGGTGCATCACGAGGTGGAACTTGGCGTACGTCCCCTTCCTTGCTTT
GTCAGGAGGATGGGTAAGAGGGTCGTGTAGTTAATAACCTGGTGGGTGCTTAGGTGGTGATCGGCAAGGGTGGCAAGGATATCACCGAAAGCGACAGTAT
GAACCACGTTGCTGGCTACGTACGTACATCGACTTCACATGTAGATGAACCTTTGCTCTTTTTGTTTATTTTTTTTACTCCACTGATTTGCATGTGTTAG
GCACTGGCGATCGACATGACGGCCCGTGATGTGCAGGCCAAGGCAAAGAAAGCGGGGCTGCCGTGGACACACGCCAAGGGGCTCGACACCTTCACGCCTA
TCAGCGACTTTATCCCTAAGTCAGCGGTACCTTCGCCTCACGACCTCAACCTCTGGCTGAAGGTGGACGACGAATTGCGCCAGAGCGGCAACACCAGCGA
CATGGTGCACAACATCCCATTCTTGATTTCCTACGTCAGTCGCATCATGGCGCTGGAGGAAGGCGATTTGCTCATTACCGGCACGCCGGAAGGAGTTGGA
CCTGTGCCAACTGACAGTGTACGTTTCTTCCTTTGCATTCTGATCCAGTAGCCACTCTCTTAGTTTGTTTATTGCTATCGTGTTGCATAAAGGTGATCAC
TGCGGGCATCACCGGTCTGATCGACGTGCGCTTCCCCGTGGAGACGCGGGTGTACAAGGCGTAGGTGTGCGTTTGTACTCCGAACAATAAATGGCACTTT
GCTCAAGTAAAGCTGCTCGATTAGCTGCAAGCTACAATTCGAGCCTTGGATGTGGTGGAGATGAGTACATTGCATGGTGTTAAATAGTTCTAACGCTGTT
TAATGGGGGCTGTCGCTGCTTCAACCAGCATAGACAACTTTCGGAAATTCTGTCTGCGTCTGGAACCAGCGAAAGTCGTCCGGACATGCCAGCCGCGGTA
GATGGCCTGGATACGCAACGCCGCTGCATCATGTCGTAGGTTTCGTACTGCGGACTGAGCATAGGAACGCACTTCTGGCCGATTTGACGGTGCTCTAATC
AGCCGCATCAGCGCACCCAGCACACCGCTCTCCACGAGTCTCGAGCGAGCCACATGCAGCTCGGACACAGCCGCCAGCGCACGTGTAGCTTCCACAAGTA
AGGCCTCACTCACGCCCCTATCGCTGCTGTGGCCAACTGTATGACTTCGATCAAGCGGACTTACGTATCGCACTAGCACAGGCAGGAGTCCAGCATCCAC
CAGCTTCAGTACATTTTCCGGGCGCTCGGCGAAGTTGGCAATTATCTGAGCTACGTGAAGTCGAGTGGAAACTAGCGGATGGAATGCAAATTGCCCCAGT
GCTGACAGGAGCGCGGGCTTACAGAGCGTAAGACGGGAGGGTGCGTCATGAGTGAGCTGAGCGAGTGCACCTAGAGCATCCACTTTCATGCCAAAGTCAT
CGCCAGCCAAGATGCCAAACAAGCACTTAACGACTCCGCGTGCCAGGAGCTCGATATAATGCTGATAGTCACGCTCGGAAGCTTGGCTTGCTTCCCATGA
GTGTGCTTGTGGACTCCCAGCCGGATTATCTTCAATACCCTCCGTATTCGCGGGATCTTGTCGCCGTTTGCGTTCGCTGCAAATTAACAATGTGAGTAAC
GTGATGACTGCACGGCGGACGCGTTTATCGGGTGAAGCGTATAATTCACGAGCTCCGATATGATCAAGCACCTTGGAACGAATAACGTGCTCTCGGTTTG
CGGTGTTTTGAGCTATAGCGCAGAAAATTACCAGTGTTGCTCGAATTACTGCGGTTGCCTCGGACGCTGGCCACATGGATGCAGACCGCAAGCGGGGGCG
CGTTGATGAAGCCGATCGAGGCCGGGAAGCAGACATCTTTGACTGGATTGGTGTCGCTGATGCAGTGCGCGGGCGTTTATCGCCTGCATCGGTTGACAGG
CTGCTCGGGGAAGAAAAGCAGAGCTGAACGAGCCTCGACATTGCTTCAGCTTGTACAAGTGCCTCGTGGTTAGCGTTATCTTTTGCGACAGCATCAAGAA
TGGCCACCACCAGCAGACTCACTTGAAGCGAGGGCCTAGAAGCACAAGATGACCCGCGACCTAGTACGCTAAGCACGCAGGGCAGGAGCCCAAGCGAAGC
GAAGCGACGAGCATTTTCCGCTTCGGATAGTAGCAAGTGCACAAAACTCAAAAGTTCGCGGCGGAAGATCGCGTCCTTGTCCAGGAACGGATCTCGCAGC
AGCCCCGACAGTGTCGTGAAATGGCCTGAATAGTAGAAGAGCACTCGGTTATCACATGAAGCTGCAAGCTGGTGTAACACGGATGCCGCTAGCGTTCGCG
TGCGTGTATCACTTGCCCCAACATTCCTTGCACTCTGCGGGACGCCACTGCCAGAGCAGCAATTCAGCATAAAAGCAAACCCTTCACGTTTGGCCACGGC
TTCGCGCCACTCGTCTGTTGTCACCAAGCGTGCGACGACTTCGAAACCAGCCAACCGCAACTTGTGGTCTGTAGTAGTGTGCAACAGAGAGAAGACGCAG
TCAATGCCCCCTGGTGCTTGAAGGAGTTTGGTCTTGATTGTCGATAACCGCACAAGCGCTGCCAGTGCTTGTGCACAGTCGTGAGATATCCCCGAGTCTT
CACGATCCACCGGCGAACTGAGCATGGTCAAAATCGCACCGAGCGTACCAACTTCGTCAAGTAGCTCAAGGTTCGCGGCTGCAACACAAGGGAGAGATTA
AGGTCTGACACCAAACACCTCAATGGACATGAAAATGAGGAGAACGCACAATTACGACTGAGAGAGGCTATCGCGGCAGCTGCATCACGACGTACTTCGA
CGAAGGGAGACCAGTAAATGATCTCAATCAGTGGGCTCACGTCATCGGCCTCAACGTCTTGACGCCGAAGGCTTTTGAGGACATGGGCACTGTGAAGAGA
ATCCCGACGGCGTTCGCCCTGCATGGCATTTAATTCAGCCTCGCGCGCTAGTAGCTGCTGTCGTTTTGGATCAGCTCGAAGAGATACCTTTTCAGGCGGG
CCAACGGCATCAGCTTTGGTAGTTGGAAGCTGGTGCCCATCGCTAGCTCGATGAAGCTGCGTCGGTTGTGAAATCCTGCGAATTGGCGGAGGGCTGGCCA
CGACATTCTGCGGCTCTTTCGTTTTTGAATTCACTATTGAGGAATTGCCGTCTTGAAGCTTTGGCTGCGAGTCCTTCCTGCTGTCTCTGCGTCCTGCGCT
GGTTGGCGATGCTGTAGTGGCGATGGCGGCTCGGAACTGCTCTCGAGGATCCTGCGGTGCTCGAGCAGTTCCGACCTCGGTAGGAGTTTGTCACTTGTTG
CTACCGAGTGGTCCGTCCTCTTGGACGATGCCGCACGTGGATTCGAAGGGAATAGATCAGTCGGAGGTGCATTCCATCGCCGCTTGGCGACTGGGGCCAA
TCCACTTCTAGGCCGGGCAGACAGCGGCTTGGAGGTCAGAGCAGCCGGAGGCTTGGCACTCGTCGCCAGCGACATCTCGCAATGGTGGAGACACAGGTGC
AGCGTGAGACTCCGTCCGCCTATATTTACATGAGGCAAGAAGCTAAACATTGAACTAGTTACCTCCAGGCCACGGCGTGAACTTGGACGACAAACGGATC
CCACTTTCACTGCTAGGCATTCTCGCGCACTTGGCATAGACGCACTTGGATGGCTTGGGGGCCGGTACAGCAGCAGTAGCCACCACAGTGCTCTCTCACT
GGGAGTTAATCGATAGAATATCAACTACTTTGGGAGGAGGCTCCCGTACTCGGCGCCGACAAGACACCGCGTTGAAGTTGTCTCGGTGGTCGAAATTCTG
AAACAAAGTCTAAATTCTAAATCCTAACTGAAACGATGAATTTTGGCCAATCACCGGAAGTCACCCCAAAGGCGAAGTCAAGCCAAGACCAATTTGTGCC
GCCATGAAGAAGAAAGTGGGTGTCGTCCTCCTTGCCCCTGCCTCTGCAGGGGCCATCTACTAACCCACGAGTGCGTCTACTGTATCGCGATGCGCGCAGG
TTCTGCTGATGGGCAAGTCCGGCTCGGGCAAGACGTCCATGCGCTCTATCATCTTCGCCAACTACCTGGGTACGGAATTGCGTTCGGTGGCTGTGTTGGA
TCCCTCCCGACTAACTGAACGATGCGATTTATGTGCCAATTGACTAGCGCGCGACACCATGCGACTGGGACCCACGTGTAGGACGGAACTTTGACGATGC
TTTAGCCCGTCGAGATACATAGAGAATGACGTTTTCCTGCTTCTTGTAGTGGACGTGGAGCACTCGCACGTGCGATTCCTAGGCAACTTGGTGCTGAATC
TCTGGGATTGCGGCGGGTACAACGACAAGAACTGTTACTGCACTCGAGGCTGAAGCTTGTTCTAATGCTGTGTCGTGGTGTTTCTTGCAGCCAAGATGCA
TTCTACGAGAACTACTTCGAGAGCCAGCGCGACCACATTTTCCGCAGCGTGGAGCTGTTGATCTACGTCTTCGACATTGAGAGTCGCGAATCGACGTACG
TGGAGCTATCGAGGCTGTCTTAGTCTGGCTGCTGATGTTTTTTGTGTGCATTGCAGAAAGATATGGCGCACTTCGACGGCTGTCTTGAGGCTATCGACCA
GAACTCAAGCAACGCCAAGGTGTTCGTGCTCATCCACAAGATGGATCTTGTGCCGGAGGACCAGCGTGAGCGCGTACGTACGCATTGCCGAAGTTGGGGA
CAAAGCAAGGTACGATGCTAACGATTTTTTTCGCGGTCATGTGCAGGTGTTCAACCAAAAGAAGGAAATGATTCTGGACCGCACGGGCCAATTGCCTACG
GTGTGTTTCGGCACGTCTATCTGGGATGAAACGCTGTACCGCGCGTGGTCATCCATTGTGTACTCGCTGATTCCGAACATGCAAGACCTGGAGAAGCACC
TCAACAGCTTCTGCTCCATTTGCAGCGCTGACGAGGTGGTGTTGTTTGAGCGTGCCACGTTCCTCGTGATCTCACACGCTACGCACACGAATCACCGCGA
CATTCATCGCTTCGAGAAGATCAGCAACATTATCAAGCAGTTCAAGCTGAGCTGCAGTAAGACCCAGGCGCAGTTCCAGGGCATGGAGGTGCGTAACTCG
AACTTCACGGCTTACATTGACTTCTTCACTGCCAACACCTACATCATGGTCATCATGTCCGACGACTCGATCCGTAAGTTCCAGCATAACTGTGTTATTC
TAGCGTTGAAATGCATTTTCATACTAACAACTTGTTTGCCCTGGCGACATTTGATTTGAGTAGAGCCCGCGACGATTCACCTAAACATCAAGGCGGCTCG
TCCTGTGTTTGAAGAACATGTGCAGCAGACGAGCTAAGCTGCTATGATGGTCGATGTAATTGCCAAAGGATGCTTCTTGCAGTCTCCACCGATTCAGAGG
CGCGCTCTTCGGAGGACATAGTACCAACTACTTGTATAGCTGGTGCTGAACCTAACTCTAATGCAGGAGCAGCTTTAACTTGACGATTTCCGAGCTTCTT
TATTTCATATACGCGCCAAGAGAGCTCCCAGGAACTCCACGCAGCGTTTGTTGGGAAATGCATTCCATGAAGTTTACTGAGGTGGCGGCGGCGGCGAACC
TGACGAATTGGTTGCAGCAAGCATGTACCCTCTGCGTCTCAGCGCACGTAGAACCACGGGCGTGACGGCGAATGTAAGTGGCCACCGGACGGGGGCCAGC
ACCTTGTAGATCGTGTAGGCGATGAGGAACGATCCGGCCGAGTTGGTTGTCGAGTCACTCACCGACGTGGACAAGCCCACTGCATCCAGAATGGACGTGA
TGTCCACGCCGCTAGAGACTCCCACGTAGATGACGGAGAACGACAGCAGCGACAGCACAATGTGCGTGCAGATCCCCACGCGGCCGTAGACGACAGCGAA
CGTCTGGGCACGTTGACGCCACGACTGCGGCTGGAGCTGCTCGTCTCCAGGCTGCTCCAGCTCCTTCTCCGCGTCTTCTTCGCCCTACACCAGCACAATA
ACACCATTTACAGTGTCAAACCTGTTGCAGCAGCTTTTCAGATCCCCAAAGGCAGCAAATCGCACCTTGACGGACGGCGACGATGTCGGTTCTCCACCAG
TGAGCGGCGCCGTCTCTTTCGGATCCTTGGACGTCCTGCCACTGGACCAGAGCCGCAGCATGCCACAGTTAGCACTGCGAGTCACAGGGAAGCCAAGCAC
ATGGCGCGACGCAGCGACGGCTGGAGGCCACGAGCAGGAAGGGGCGTGACCACTCTTGCCGCTGCTGGGGATGCTGGAGGACAGCGCTCGCGCCACGACA
AGGCGCGCCGCCCGCTGGAAGTCACATCACGCTGCGCCATGCCCCGATAAGCGCCCAAGTACCTCATTCCGCCGCGTAGCATCATCGAAAAGGACGCAGC
GAGGCTTGCAGCTTGATGACTTGGAATATCCACGATGTGGTGTACACCAAACACGACACTTTTCATCCTCCAACTGTCCCACACCGCGTCTTGGGCACTT
GAAGCCATGTTTCGGGCTCCGACGCGCGGCTTCTGGGCGCTCCAGCGTCAATTGCGCGGCGTGTTGGCTGCCGATGCGTCCTCCCGAATGGGCGCCGGTC
AGCGTGCGCTACTCGCCACCACCAGCGAATCCAGAGACTCCGCGGAGTCGACCCACCAGCGACAGCAGTCGTCGTTCCTGCGCAGCGTCGACCTGAGTAG
CCCCGCAGCGCAGCGGAAGCTGTCCAAACTGATCCAGGAGGTGGTCAAAACCAAAGCCAATACCGGTGGTGCGTGCTGCAAAGCAGTTGCTAGAAGAGGA
TAGGAGCTCACTTCTTGCTGCTACGGACAGATTTCGTGCCGCAAGTGATCGTCCAGAGCCTATGCACGACGTACCGAGGCATGGATATCGACGAGAAAAA
GCAGTTTCTGCTCATCTTGGCGCAGGACCTACACATTGACACGGCTCTGGTGCGATGGATGGATAGTAGGTAGTATTTCCACTTTGTGGGACTGACTGGG
ACTCTTTTGTTTTGATTCTGTTGACGGTGAATAGGTTCTGCAAAGTGCTGCTCAGTTTGAGCAGAACTTGACTAATGTGCAAGACGCTCGCAGTGGTGTG
GTGGGCTGGGAGCACGAGAACGTGGAGCGGTACTTGCGCACGTTTCGCAATCTTCGCAATGCTTTGTCACCACTGTATGAAGTAAGAGGCATTTACGGGG
CTGAAAACTGGATGGGATGCTTTCGAGGTTTTGTACTAACGGTAGCGACGCTTTCGACGGGGTAGACCTTCTTCCAGCAAATCTTGTCGCAACGCGAAAA
CGGAATGTTGTTCTTGGTACACATGCGAGCAGACCTGCTGCAGGTTTTGCGCAAAAACGCTAGCCATTCCGAAATCCCAGCTCTCCGTTCTTTAGATGCA
GGCTTAAAAGTAAGTCTTCATGTGTGTGTTATGTGTGTATTCATCTGGATTCAACCAATTACTCAGTATTCACGCGCCTTCTACACAGCAATTCCTAGCA
GCGTGGTTCAGCGTGGGGTTCCTGAAGCTGGAACGCGTGACGTACGAGCACTCCCCAGGCCAACTTCTGGAAAAGATCATTCGCTATGAAGCAGTGCACC
CAGTTGGTACAATCGCCGAGCTCAAGCGGCGCCTTGGTACGTCCGTGCAATCCAGAGCAATTGCACTTGAATTGAAATGTGACCCGTTTTCGGTTCTGCC
TTTGTATTGTACTATGCTAGGCAATGGACGGCGCTGCTTCGCGTTTTTCCATCCGAGGTAAGATCTCGCATACCATAATATTAATATTTAAGTCTGATCA
TGGATGTGCATGTGTTGTAGTATTCCGGATGAGCCGCTCGTGTTTGTGCATGTAGCACTGATGCAAGAGATCGCCTCCAGCATGCAGTCAATTCGTGACC
AAACCGAGCAATTGGCAGAAGCCTCTCAAACGAAGGCTGCCATTTTTTACTCCATCTCCTCCACGCAAAAAGGACTTTCGGTAAGGGGTATCGCTTCTGG
CATACACATATCATTGAACTGATTTCGTTTATTCCAGGGTGTGGATTTAGGCAATTTTCTCATCAAAGAGGTTGCCAAAGCTCTCAAGGTGGAGTACCCG
CTCCTGAAAACGTTTGCGACACTCAGCCCTTGCCGCAATTTATGCCATGGCTTGAAACCCAGCGATACAAGACTGATGAGTCGCTTGTTTCTCCTCTCGA
CTGGATGCCCTGATCGATGTCCTGGACGAGCGTGGCGTTACGATCAACCCGATTCGACCGCTGTGGCTATTGTCCTGGATGCACTCTCTATTGATGATTG
GAGCAAGGATGAAAATCTCGTTGCACCGTTGAAGCCTATGATGCTGAAGCTTGGCGCCCGCTATATCTACCACGAAAAGAAACGAGGTAAGGCACTGGAC
CCCGTTACTAACTTCCACGTTCGGAATGGTGCCATTTTCGAGCGGATCAACTGGTTGGCTGATCTATCCAAGAAGGTGCGTGGCTCAGGCGGTTGATCGT
TGATGTGCTCACAAAAAACCTACTTATCGATTTGCGATTTTTGTCCATGACTGCTTCATAGGGCCTCGCGCAAAGTGCTGGCATGATGATCAACTACAAG
TATGATCTAGCACACGTGGAGGTGAACAATGAGAACTACTTGCTGCACAACATCATCCCCATTGGCCTCCAACCGCAGCAAGTTCTTGGAGCGCGTACGC
TTTAATTGCGTCGCAGGAGAACTTTGTGTAGTACTTGCCAGTAGTAGAGCAGAAAGTTTGCTTGAATTCACAGTCTTGACACGTAAGGAACGTTTCTGTT
TTTTGTTTTAAAGAAATCGACCAGAGCAGTCTTTTCTGGTATCCCTGTGAAGAGTCGTAGCGCAACGAAGCCGTGATGGTGTTGGCACAGGATGAGATCG
ATGCTTGTCGGGAGGCATTCCTGGCTTTCGACAAGGATCGGTGAGGGCATTACAGATGGCCGTGCGATGATTGAACCTGACAGTGTGCTATTTTACGCTT
GGCAGGAGCGGAACAATCGATGTCTGGGAGCTGCGTCAAGTGCTAGAAGGTAAGTGCTGCGCCGGCTCTGGTTATTCAGGATTTGTTCCAACTAGCGCGT
CTTGGATCAGCAATGGGGCAGCAGCCAACAGAGGAGGAACTATTCCAGATGATCAGTGAGGTTGATGAAGATATGAGCGGCGCAATAGGTAACCTTTTAG
ACGCGACTGCAGCGGATATTGTACATTTAATCCTCATGCCACACCGGTACCAGACTTCGCTGAGTTTCTGCAGGTGATCGACAATCAAAAGGATCGCGCC
GCTATGTTTGAGGATGACAGCGACATGAGTACGGGAATTTCGATTGAGGAGATTGCGGGAGGCGCTCTAAGTGTCATGTGTGCTTTCGTAGTTGATGCGT
TTGTTGCGTGCGGTGGCAAATCCGACAAAACGGGGTTTGTGCGCAAGGAGACGCTCGTGAAAATTATCAAGAGTGACTTTGGTCTCACTATCAACATTGA
GGAGATGATCAACAAGCTAGACGTGGATGGCAGTGGAGAGATCGAATTCGACGAGTTCAAAGCCATATTAACCTA