Description :
From Genome Similarity Track
Location :
Scaffold_64:219835- 220930
Sequence
1095 bases(100 bases per row)
GCATCGCCAGCAACATCAACTACTGACGTGTTTGAGCGGGACATTTACGGGTTCACAGTGTCATTGGAGTATTATCGAGAAAGAAGCTTACCCCATAGTC
TGTGCATGCGATAAATTGAGTTATTTACTGCTACGGCCTAGCGGGTTTAAGCTGTTCTGCGATCATAGAAACCTTATCTATGTGTTTGCGCCTAGCGTGG
AGGTGAAGAAGCACATCCGCGGCAAACTTTTAAGGTGGGCGACGAAAATTGCAGAGTATCGATATGAAATTGAGAACATCGATGGGGAACTGAACGTATG
GAGTGACATGGTCTATCGTTGGGCTCGTAACCACGTGCAAGAAGCGCACTTACGCCGGGTGATACTTCGAGATCGACCTCAAACCTCTTCCTCTCACACT
GCACCACCCAAGAAAAGAACTCGGCGGCGGCGAAAGCGCCGCGGGCAAGAACACGTACCTACGCCTACGATACTACCACGATCTATTAGACCATTGCGCG
ACCCGGATTTCGTGTGGCCGACCAGAGCTGCCATACTTGACTCCCAAGTCAAGTATAAGACAAGTCGACCTGAAGGAGCTATTGGTAGTGATACTGAAGG
GTGGTATATGAAAGACAAGTTGTGGGTACCCGATGGTGATGAGAACCTAGTACAACGCATAATTGTCGTAGCTCATTGCGGGCCTCAAGGACACCGGGGA
CGTGACGCTACACTGGAATCGATACGGAGGTTTGTCTACCTGGCCCGCCTTAGAGCGCGGGTGGATAAATTTCTATCGAATTGCCCTTTGTGTCATCACG
TCAAAGGTGGCAAGAAAATTCAAAGACCATGGGGTGAAACATATTGGACAAACGAACGGAATGGTGCACTTCATTGGGACTTTTTGTCATTTGGAGAAAG
TTTTGCTGGTGATAGTTATCTACTGGTACTTAGAGATGAAGCGACACATTTCTCCGAGCTGACACCATGGTTAACTCCGACTAGCACTGTGGCTGTAGAA
GATATCCTTGCATGGCACAATCGGTTTGGCATACCGCCATTGTGGATAAGCGACCAGGGGTCGCATTTCAAAAATGCAGTGGTGGCAGAAGTGTG