Description :
From Genome Similarity Track
Location :
Scaffold_5:219821- 221547
Sequence
1726 bases(100 bases per row)
GCTCAACGTTCAACTACGGTTGGTTGCCCTGAACTATTCACGACTGTTTCACGTCACTTGTAGGCAGCGATCGTGCTTTTTGATCGATAGATACTATGCG
AATAGGCAGTGCCGTCGGGCACGACCGCGAACCTGCTGAAGCTGTCCACCGAAACGATCCAGCCCTGCATCTCGCACTGCTTATAGTTTGTATCTACTGG
TATCGTTGACGCTAAAAGCCTTAAGCAGCAGCTCAAGCACGTTGGTGCTGGCTGACGAGCTTACTGAACCAGGAGGTGTTTTCCACAATGTCCTGCGTGC
CGACCACACTCAACCTCACAGTCATAATAACGATAGATAGTAGATGCTGCTGGGGACTAGTGAGTTCTGCTCTTCCCCGGCGAGCCGAGGTTCAGCGCTT
AAGATTGTGTAGTGCCCACTCTGTGTCCATGGATATCGCGAAGACAACCCGCGAAAACGTGACGGATAATAAACAATTTACCAGTGTTATGACCTCGACT
AAGGCCATTACAACGAAGCCCAATGTCCAACAGATACCTAACTCCAGGGCCGTCAACTCGAAGCAGACCAAGGCCCAGTTTAACCCCGGCCTAAGCACAA
AGCTAAGCGAAGAAGGCGGAGGCCAAAATGACTAAGATGTTTCTTATCGCCACGCAGCCTAAAAACACACAAAAGAGATAAGTTGTCGCTGCCAGCGATT
CGAGTTCATTAAACCAACCACTATCTCATGAATCTTCCATGCTAGCTACCACGGACTCTTTCGCCCTGTGTTCTTACACGTCTCCGAAGTATTCACTAGC
ACAAAGATGTCGAGGTTTAGCTGGCGAACCTGAGGCTGGCTTTTATACATTACCCTGCAGCTCTGCCCAGCCACGAACGTATGTCGGGCTGCTCGTTGGT
GTGGCTGACGAGCGCAAAGTTCCGCCAGTAAGTGAATGTGCGCATCCGTCAAAGACAAACTTGGGATAGCCGTATTGTGAAGCATTAGCCGGTGATATTG
GGAATATTGTGGGTCTAAACCAAGCAAAAGTCGTCAAGTTGGCACGTCTGTATTTAGTGGTGCAGTTCTGTATTCCTGCACGACCTCTCTGTAGGACTGG
TAGTGTCTTCTGTAGGTTGTCGCTACCCTCTGTAGATTTGCACCACGCTCTGTATTTTTGGAGCACCTTCAGTAGAAACGGTATGTTTATCTGTAGTTTC
CACCCGCTCTCGTTGTCAAGTGGCTGCATGCCAATCGAAAGGAAGGCTGCACGAAACAAATGGCTGATATAGCAGCATGCAATGGGCAATTGCGCGTGTT
GCGGTGGCTTCGCTCGCAGGGGTTGGAGGGCTTTCCAATTACTTGCATTGACAGTGCAGTTTTGCACTCGCAGTGCCACGTGGAATTGACAGAGCACTCG
GTCATTCCGGTGGACATCGCCCGAGGTTATTGACTGGATCAGCGAAAAATACTCACATTTCCGCGTAGGGGATCAAGCGTAGTCGGCGCGCAGGGAGATC
TCAAAGTCTGAAGATGCAGAGGCACAGGCACAAATTTTTTTCTTCGTTATGAAGAACAATGACAAACTGCAACTGAACTGCACTCACCACGAATCCCATG
TAAAATACATTCGCTAGAAGCTGAAGATAGACAAGGCATCAGGTAACGTTTCCGAAGACGTCTTGTATGGTTTTCACTCAACACACTGGACGAGTAACAT
CTATTTAACTTAAGACACTGAAGACA