Description :
From Genome Similarity Track
Location :
Scaffold_4:219776- 220851
Transcript NameFunction/comments
Aphin_H310_05270Hypothetical protein
Aphin_H310_05271neudesin precursor

Sequence
1075 bases(100 bases per row)
TCGGCGCAGCGGTGGAATTCCGATTCACAAATGCTTGTCCTGTCAACGTGCTAGTGCAAATGGACGAGGGCCGCGTGATTTGCCGCCTCGGGCCAAATGG
GTCCACGTCCAGCATGTGCCGCGCCACCGCGACTGCAGCCCAAGGCTCGTTTCGTGTCGTTGGAGACGTGTTGAGTACGTGGGGTGTCGTCGACGTTGCA
TGGAGAGGCCGCCATGCGTTCGTGTAGGTCTGGCGTATGCGCAGGACATGCCCCGTGATGCATGGTGGCAAGTTCGGTTTGAATTCCACGCTGGACCAGG
TACAAGCACGAAGTCCCATCATAGGCACTGAACGTGTTGTGGGGTCGTCAAGGCACTCCAACGACCGTCGCGCCCGTGGCATTCCAACACGGGCCTTTGA
CTTGCCAGCCACTGTCGTCCACCGACTCGACCCGGCGGCCGACGCGGCACTGCCCGCTGAGCGTAGTGCTCAACGTGACGTATTGTTTGCCGACGACAGT
GCCAACTCATGGTGGCCGCAGTACGGCCGAGTCCACGTCCGATCGTGCTCGCGGTTCAGTCAGCCCAGCTCGCCCCGATCCAGTCGCCAACCCGACAAAC
CAAGACAGTCGCACTCGTCGTAATGGCACCAACGATATATCGACGGCAACGACAGATGCAGTCGCTACCAGCAGTGCATGGATCGTTCTACTGATTGCAG
TCGGTACGGTGGCGTTGTCTACAGTGGTTGCTCTAGTGCACGACGTCCAGGGGCACGTTCCCCCCAAGCTTCCCGCCCCACGACAGCAACGCACAACGAA
AATGGCACGTCGAGTTGACGACGTCATGCGGTCGAGCTGGCTGTGAGAACTACGACGAGCGAGGCATGCACGATGCGTTGTAAATCTATTGTGCATTCGA
AGCCCGTTTATTTGTCTTCGGGGAATCTCGTCACAGCAAGGACGCCGACCTAAGAAATGCAGTGGGAGGTACAAATCGACCGAGCTGCCATACCTTAGGG
TACTTGCCTTGGTAGAACGACAGGGTCGCTTCCAGCTCCTTTTCTTGCGCTGGTGTGAAGTCCGACACGTCGTCG