Description :
From Genome Similarity Track
Location :
Scaffold_1726:2197- 5853
Transcript NameFunction/comments
Phyag_g11352hypothetical protein
Phyag_g11353hypothetical protein PHYSODRAFT_510353

Sequence
3656 bases(100 bases per row)
GGCTGTTTGTTTTGCCATGGTCAACACTGGCTGAAGGACTGTACGACTGCCAATGAAGCCCAAAAAGAGGAAGCGCGGCAGAAGTTTGCACTAGAGCGTC
AGCGACGCCGCGGGGACCGTTTGAAGCATCTGAATGATGGTGCCGATGTCAACATGCACGCTGTTATCGGTGACGTGGTCGAAATGCCACTCTGCCTCGA
CACTGGGTCGGACCATAACGTGCTACCTCGACACATCCTTGAGCGAGTTCGTGAGCTGGAAATTGAGGTGGTAATGCGTCGTCTTGACCCCCCTCTCACC
GTGACAACCGTCGGCGGTGTCGAGATGGCATGTGTGGAGACGGCGTCTCTGGACGTGTCTATCCGTACCGCTGCAGGACCAGTAATGTTACGGGCGCTGG
AATGCCtggtgctggatgctgaAGAACCTGAATTCCTGTTGGGACATCGCACCATACAGTCGCTGGGCATTGATGTTGGGCGACAGATGGAGCAGTTAGC
TGAAGGCAACCTTGTTGCCGAGCAAGATGCCGACGGTAATTTGCCTGCAGAACCAGTGCTCGATTTCAGCCATGAACGAGAACAAGTGCGTGAGAATCTC
GAGCGAATgctcgatgaagcagcacagGAAGCGGACGATGACGCATGGACTGTTGAACTGAGTGCACTTGCGATGCGTTTTGAGGACGTGTGGCGTGTTA
ATGTCGGACCGGATCCTCCGGCTGATGTGGAACCGATGCGTGTTGAACTTGTGGAGGATGCTCGACCGTATCGAGCAGGAACACGCCGATACTCGCCGGA
CCAACGGCAATTTCTGCGTGACTATGTTCGAGAGTTGGAGCAACATGGTCTTGTGCGCCGCAACAACGAGAGCCGATGGGCTTCTCCGGTTCTGCCTGTA
CGCAAGCCTGGCACCGACCAGTTCCGGATTACAGCGGATTATCGAGCTGTGAATAAGATGACAGCTCCTATCGCCGGAGCTACGCCAAAGCTTgcggcag
caatggcgaaTGTTAAAGGGGCTGTTGGCTTTGGCCAGTTTAATTTCTTCAAAGGGTTCTGGCAGTTGCCATTGCAcgaagaaagccaagaacTGTTCAG
TTTCGTGACGGAGGATGGAGTCTTCACGCCAACCCGAGTACCCCAAGGTGCGTGTGACTCCGCACTGCATTTCCAACTGCAGATGCATGCATGTTTTCAG
GAGATGCTGTACAACGCGGTGCTGATCTGGATAGATGACATACTACTTTACGCCAGGTCTAAAGCCGAGTACCTTGAGAGGTTGGAGCAGTTCTTTGTGA
TTCTTCGCGAACGTGGTCTGAAGCTCAATGCACTCAAGTGTCGTTTGTTTGCTCGGAGTGTACGCTGGTGTGGGAAGATTGTAACCGGCCAAGAAGTGAA
ACATGATCCGGCTCGACTCGCAGCATTGGTGAACATGGCGCTACCACCTACGGCTGCTGCATTACAGCAATTTCTGTGTGCGGCTAATTGGATCCGCGAT
ACTGTGGTCGATTTCGCTCGAGTATTCGCCCCGTTGCAGACGAAGTTGGAAGCGGTGATGGCTACACGAGGgcgtcgccgccagcagTTGACAGGTGTTA
ATTTGACGTGGGATGGAGAGGAACAATGTGCGTTCAAAAATGCAACGGAAGCACTCGCTCACTCCTCCCCGCTGCGGTACCCGTCGGAGGCTGCCACCAT
CAACCTGTTTTGTGACGCGAGTGCTACTGGTTGGGCTGTTGTGCTCACCCAGGTACTCGAATGGGATCCGAGCTTGGACGTGGTTGAGCAAGCTCACCAA
CTCCTCGTATGTCAAGGAGGTATTTTCACACATAGTGAGCTGAACTGGAGCGTGGCTGAGAAAGAGGCGTACCCCATTGTCGCTGCATGTGCCAACCTCG
CCTGCGTTCTCGAACGTCCAGCAGGTTTCCGAATTTTCTGTGATCATGCAAATTTGATTCACATCTTCGCGCCGCATCGTGAAGTTCGTCAACATATTCG
AGGCAAGTTGCAACGGTGGGCATTGAGACTCTCTGGTTTCCGCTATTCAATTGAACATGTGAGTGGTGAGTCGAACGTGTGGGCCGACTTAGTCTCACGC
TGGGCGCAGCCCTCCGAGAAGGACACGTCCGTGCGACGAGTGACAACTCGTCAAGCCGTGGAGCTATCGCTGCTCCGTCCGCTCGAAGACGGACAGTTTG
TATGGCCGAGCCTTGGCGAACTTAAGCATGTACAACAGGAGCATCGAGCATCCGCTCCTACCGTGACTACTGAACACGAGGGAGTTCTTCGCGTCAACGA
CCGTCCTTGGGTTCCTGGTGATGCTACTGAATTTCTGACAcggctgctggtcgtggctCACTGCGGACCCCATGGTCATCGTGGAGAGGACGTGGTAGCG
gagcttcttcgacagcgGTTTGAAATACcgcagctccgccagcgAGTGCAAACGTTTAGTCGACAGTGCCTGTTGTGTAAACACGTGAAGGGCGGTCACC
TATTGATGAGGAAGTGGCAAGAGCATGAGATGGCCACAATGAGGAACGAGTGTTTACACGTGGACTACCTTTTCTTGGGCGACAGTTATGGTGATGCGCG
ATATGTACTGGTGCTGAAAGATGAGTTGACGCATTACACTGAGCTCGTAGCGTGCGACTCGCCGACGGGGCtggtggcagcaacggcCATCCTAGACTGG
CATAAACGGTTTGGGCTACCCGAGACTTAGGTATCAGACAACGGTACCCATTTCAAAAATGAACTGATGCGCGAACTGGCCACCCGCCTCAAGGCAACTC
ACAAGTTCGTCCCTGTGTATACCCCGTGGATTAACGGCACCGTAGAGCGCGTGAACAGAGATCTACTTCAAGTGCTGAGGGTCATGCTGCTAGAGTTGCA
GATGGACACAAGGGCCTGGACTACGCTCCTCCCTGTGGTTCAGGCAAACATGAACCACACGCCCGTGCGCTCTTTGGGTGGACACGCACCTGTAGAGCTG
TTCACGGGGCTGCCACCTCCGTCCCCATTGGATCGCGTGATGCAGCCAGTTGACAGCCCCCCGCGTGAACTCCCTGCGGAGAGTCaagaacttgcagcag
ctctcgaagAAGTACGCGTGCACCTTCGAGAACTGCATCAGGAAGCCACTGATCGCAAGGAACGCCGCCGTCTGCTTGAGATGGCGAAGCAGAAAGGGTT
GCCATGCAATTTTGAGGTCGGAGACTATGTGCTGTGGTCTCGCATCGACAAGCGCTTGCGTGGCAACAAGCTACTTGTTCGATGGGTGGGTCCGTTCCGG
GTGCTCCGAGCGCTACCACACTCGTTCATGGTGAAGCACTTGCTCACGGGGGATGAGTATGAGGTCCACGGGTCGAGATTGAAATTCTATCACGACTCTG
ACCTTAACGTGACGGCTGAGATTCGCCAACACGTCGGAAACCAAGGCATCGTGCTCGACGTGCGTGACATCCTTCAGCACCGTTTCAATGAGACGACGCA
AGAGTGGgagctgttggtggcgtggCGTGGCCTGCAAGACGAGGAGAACTCGTGGGAACCATTCGGGGCAATGCATCATGACGTCCCGGGCTTGGTGCGT
CAGTATGTGGAGCGCACCAATGCGGCAATTTTGGAACGGTTTCTATAACTGTGGTC