Description :
From Genome Similarity Track
Location :
Scaffold_551:21969- 25952
Transcript NameFunction/comments
Phyta_totarag9210hypothetical protein

Sequence
3983 bases(100 bases per row)
GAAACGAACCCGGGCTCTAGAACCTTGGTTAAACTCATATAAGAGTGCACCACAACTGAGCTGAGACATCGGAAGCCACTCAGGATCATCATGTCTTTTC
CACTTGACAAGATACTCGCGGACACGTCTGGCCGTGCGTGTACGTTTCGTCCATTGCAAATCCAGaatcttctccacttcatATTCGTCATTCTGAGTGT
CAGGCTCCCAACTGTCTTCGGGCAGCAATGCTGCGTCAAAGTCATCCTCTTCATATGGAGTGATCTCCACTGTTGGTCGTCTAGGGAAGAGTGCGCGAGA
TTTCAGACGACTCACGTGTACCCAAGGGTTGACGCGGTAGCTTGTGCCCTTGACCTTTAGTTTCACTCGTAGATCGTCATGAATTTCTTCGATCCTGAAC
GGTCCATGCCACAGATGTGCCAGCTTCCGACTCAACCCAGTCTGGATCTTCGGGATATATAACCATACTGCATCACCTGCTTCGAAACTAGACTTGAGTC
GTTCGGAGAGCTCACGCCACTTCAGGGTTTGCGCTTCTGAACGAGCACGCTTGGCTTTCTTCTGAAGATCCTTGGCGCACGCCTGAGCGTAACTGTAATC
CCGCTGAAACTTTCTGCGCCACTCGTAGGCAGTCCGTTCTGGAATGCTCGAGGGATTTGGCCCCAGCATGGATGAAACCGTACCTTGCGCATCCCATCCA
TGTATTAAGTAGAATAGCGTATCCAAACGAGTCGCATCGAACGAGAAATTCAGAGCGTACATCAAACGTTCAGCGTATTCATCCCAGCTAGACTGGTCCG
CTTCGGCGACGTACACTCGAACACTTCGTATGACTGTCTGCACAAATCCTTCTTGCTGACCGTTGGCTTGTGGGCGGTAGGCCAGGGTGGCCCGCTGCCT
GCTACCCAACACTTCACGAAATCATGTGAAGACTTCGCTCATGAAACGAGGGCCCTGATCGTGACGGATCATAGAGGATGCTCCGAACCTTCTGAAGCCA
CACGCTTCATACACTTCTGCGACATCCTGAGCAGTTGTGGACGACATCGGCTTGCACATGACAAAACCCGAGAAGGTATCCTGAAACAGGAGTAAGAACG
TGTTACCTCGCTCAGACTTCGGCATATGCGTCACAAAATCCATTGACACCAACTCGAACGGACGTCTCGGTTCAATGTTCCCGGGAGATGGCCCAGGATT
CGGGGGTCGCCCCTTACCACTTGCACAATCCACACGCATTCTTTCACAAATCTCTCCACGTCAGCGTACATACCAGGCCAAAAGAATTCTGAACGAATTA
TCTCATGAGTTCTGGTGATACCTTGGTGTCCGCCTTGAAAATACTCGTGAGCATAATGTAACATGTCCGAACGAAACAACTCTGGTACAACCAGTCTGAG
TTCATCTACGGCGTCATGCGGTCGATCCCGAGTGGAACGGGTGAGACGGTACAGAATGCCACGTGCATCCAGAGCGAACAGGTCCGTAAGCTTAGCGACA
TTACGGAGACGTCTTGGCGCGAAATTGTTCATGTCACCATTCAGGAAGTCCTTGATCTTAGGCAAAttctcgtcttcatcttAATGAACCTTGATGCGAC
GCCAGCGCTCAGCTTGGCACTCGAGGGGTTGCATAGGTTCATTCGAACTGGGCACACCTTGATGACCCGCCCACGTCCTCACTGCCATCACCTTAGCGGT
GTCGGGCAGGGATGCGGACTCTGGTCCAAGGAAACATACATCCTTGGGTTGACAATCAACCGGAACGGCCTTCTGACCCGGAGCATTGACCTCATCAGCA
TTACGCCCATCTAGGACCATCACGGGAGGTTTCATCAACTTTTCGTGAATCTTCAGTACTTGTTCCAGGTGACCTCGTTCGGCGTCATCTTGAAGAACCC
ATGATTCGCCAAGTGACAATGTCTTGGAGGTCAGGTAGTCAGCCGCCTGATTTAAATCCCGCTTGCCGTATCCCAGCTTGAGCGACCTGAATTTAGCCTT
CAGTGCTTCACACTCGGCAAGTCTCCGCTGAAGGTTCGGCTGGTTACAGTTGATGCGACTTTGGACCTGCTTAATGACGATTCGAGAGTCTCCAACAGCA
ATCAAAACTGAAATGTTTCCTTCGAGAGCCATAGCCATGCCTTTTAAGAGATCGTGATATTCAGCATCATTCACCGTAACATCGTTCAGGAAGTATCCGC
GAGCGTCGATGACATGCCATCCGGGAAGTTGCCACAAAATGCATCCACGGTTGCCCTGGCGCGTTGACGTCTTGGCAGCGCCGTCGAAACTTATGACAAC
ATCCTGATTTTCATCCCCCAACATCTCCACGCTGACCACCGGTGGCGGCTTCACTCGCCCCATGACAGGAATCAAAGACTCGGTAATCTCATCCAGATGC
TCTCGCGGCGATATGCCTCCACTCAAAGTGGCAGCTAGACCATCCTCATCTCGTTGGGCTCTGCAAATTTCCATGTCCCATTGTGAGAGCATAACACCCC
ACGGCACACAGCGACCATCAGCAGCCTTCGACTTGAGCACCCACGTCAAGACAGAGCATCGCGTGTAGATGACTAACGGACATCCTTCAACAAGAATTCG
GAATACTTGCAGCACTCGTATTATCGCAACGACCTCTTTCTCAGCGATGTGATAGTGGAGCTCAGCGTCGTTCAAGGCACGCTCCGTGAAACGGACTGGT
TGAATGCGTCCACCATGTTCTTGACTGAGGACAGCACAAGCTGCCCATTGGTTGGCATGCGGGATGATCAAGAACGACTTGGACCGGTCTGGGTGATGTA
GCATCGGGGTCGACACAATCTTCCGTTTTAAGATGGCAAAATCCTCATTTGCACGTACTTGATCATCCGCTAGTTCATAcagaactgcagcaaccacCGG
GAAATCCTCAATGAACTTGTGGTAGTAATTCAAACTACCCAAGAATGATTGGACTCCCTTCAGAGTGGTCGGAAATGGCAGCGCCTGTACGTCCTTCGCA
ATCTTCGGGGTAGCCCGGATGCCCTCTGCACTAATCACGTGAGAAAGGTATGGGATTGACAATTTGCCAAACTCACTCTTCGGTAAGCTCACCATCATAT
TCCAGTAGCGAAGTTGATAAAAAAAGTGCATTCAGGTCATCGCACAGCTGTTCCCATGTAGGTGCCCCATGCGcaatgtcgtcgatgtaTGAACTGCGTC
CCAGGACAGGGCTGGGATATTCCTCTTGAACACCGTCAATTGATCAGTCAGGTCTGGCAAATACCGTCCAGGGCTACTGAGTTTGGATTGACCCTACTCG
GAATGGTCCTGCTCCGGCTGGTCATATTCGTACGGGTCAAGCTGGAGGGAGTACAGAACATCTTGATCCACTTAAGTTGCTTCCTCAGGTGGCAACCGAC
GCAATTCCCACAGACAGTTATTAATCACGTACTGATAAATCAGTGGCGCGTTATTCAGTCCTAAAGACATCCGCACCCTTTGAAATATCCAAAAGGACAG
ACAAAAGCTGAAATCAGTTTTCGTCGCTCCGTCATCCTGATCACCCAAAATCCACTCGTCATATCCAGACTCAGAAACCACATTGCATTCTCGAAACCGA
ACAacaagtcgtcgatcagCGGCAACAGGTAATTGGAAAGCTGAATCAAACCGTTGACAATGCGATAGTCGATGTGCATCCTAATGTCGatgccgttctt
cttggcacAATGACAATCGGTGAAGCCCACGGGGATTCTGAATGTTCAATCGATCcagtctccagcagcttcttcagcagcttgtacacCTTGATCGCAA
GATGAGGTGCTATCGAACGAGGACGTTGAGTGACAGGTTCGGCGTCACCCACATCCAGATCGTACATCAGTCCACGGGCAGGTGTCGGAGCGTTGCCATC
ACCCAGGAAAATACGTCGATGTACTTCAGGATAGACTTCGACTCGGGTTCTTCATTCGGGGTACTCGTTCCAGGTTCACCCAC