Description :
From Genome Similarity Track
Location :
Scaffold_7:219636- 222759
Transcript NameFunction/comments
Albla_Nc1401141030S ribosomal protein S16 putative
Albla_Nc14011420nucleolar protein putative

Sequence
3123 bases(100 bases per row)
ATGGTGGTCCGTTTACGTCTAGCGCGTTGGGGGAGAAAAGATGTCCCGTTCTATCGCATTGTCGCTGCTGATGCGAGGTCACCAAGAGATGGGCGACATC
TAGAGATTGTGAGTAAAAATTGACTGTAATATTTAATACTATTCGTATTCTTCTTGTAGCTCGGCACGTTTAATCCAATCGCAGACGCAGCGGGTATCAA
AGAACTCCGAGTCAATCGCGATAGAGTACACTATTGGATGTCTGTTGGAGCACAGCCCTCTGATCGAGCGAGTTACCTTTTCGGACTCGCAAACGTCTTA
CCAATGCCACCGACTCGTCAGTATACGAAAAAGTGTATACCCAAAAAAGATCGAGAAGCTAAAAAGTAAACGGTTAATGAATCGTAGTATCAGATAGTTT
ATCTTGCAATCATTATGAAGCAAACACTGTAACACCGACACTACTTTGCCGATCGTTTCTTCGTTTTGTTTACTTGCATACTTCCTCCACCCTTCAACAT
GTGTCCTCCTTTGCGTACCTGCTGGTTAAATGTGGCATTCTGTTCCTCCATCCACGAGCGAATTTCTTTCTGTTTCTCGCGTTTCACTCCGAGTCGAGAC
TCTTCTTCCTGCTGTTTCTCACGAGCCAGAAATTCAGCATCACGACGTAATTCACGTGCAGCTCCTTTTCTCGCTCGTTTCACTTGTCTCTGTAATTGTT
TCACTTTTGCCTTATCGCGATCCAAAGTCTTATCCTTACGAATCGCGTAATTCGCGTCATACTTTGGTGTAAAAGTGGGCAAAATAGAGGGCGCTGCTTG
TTGCAGTCGTAAGGGACGTCGTAATTTCCAGCATTCGAGCGTAACCTTGGTCAGTGTTACCAAAACGGTGTTCATATCGGATATCGGCTTTGGTAACATA
TTTGATATCAAATGTAACTGAAGGTATACAGGATACATGAGCGTATCGATGGAGGCAATGTGTTCGTATTGTTGTGTTGCCAATTGGATCAGACGAGTGG
TGGTTCCGAGAATAGCAGGTGCCAGTTCAGTAATATTGCTATCTGCTATTGATAATGTTGGTAGTGAAGATGGATTCGTCGCAGCCCATTCTTTCAAACC
ATCGCTAAATTGGCTTCTTCTGTGTTTTGGGCAAATATATAATCCAAGTATACGCTGGAAACACTGGATCACTGTATACAAGCAAAATTTCAGTGTGTAA
CACGAATGTGGGATGGAAGCAATTTACGCACCTTCAGGGCAAAATCGTTTCTTTGTTTTTGTAATTTCTAGAGAGATGGCGCACATCGCTAAAGCTTGTG
TAACGTCATCACCGGACTGTAGTCTCAGAGTACTCAAACATTCCGCGATCAGAGTCTCCAGAGGTGAAATGACATTATGACGCAGATCGGAAATCGAGAA
CACATGTGTCATCAGCCTAAACACCAGAATTTCACCTGTGGCCGGCCACGACCGCTTCATTCTGCATTCTTGGCTTCCTCCACGTAACCTTTGTCGGTAC
ACTTTGGATACGAATTCGCGAAAGAGTGAACCAGCGTTTTGGGGTAGCTCTTGCGCTAGGATACATAAGTGTTTACATATCACATCCATCTATGATCCAA
TAAGAATACGGTTAGCACACGTATGGTCACAAAAGATTGCAGTATACTCACACTTTCTCTTTGTCGTGTATACTGGCGACCATACACGAGCAATAATTGA
AGCAATACACTCATCAATGTCTTTATCTTTTTCTGATTGGCAACACTGAGTTTTGGTGAGTGATACTGCAGGAGCCGCTCGAGAATCTGCGACTGTGTGC
GGACTTTCTGTTCGACATCTTGTTCATCCGTATATTTGGTAAATAGGTTTTGCAATTCTGCGAGTGTTTGCGGACAATCAAAAACATACGGTAGCTCAGT
CGCAGCTTGCGCACTCGCCCGAATCGATTGCTTTTCTTCTACCAAAGACTCAATCGAATCCAACTCTGTTTCATGTTTCATCTCATCACCATCGGAATCT
TCACCCTCTTCGCTTTCCACTGACTCTGCACCATCCGATTCATCTGACACTTCGCTTTCCGACCTCTCTTGTTCTGGCTCTTCATTATCCGACTCTAATT
CTGTTGGATCATGATCCGTATCGATTTCTGCCTCATCTCCCCCGTCCACAGTCCCGAATATTCGTTTCATTTCATAATTATCTCCCAAGTCATCATCAGT
CGACGGGCGAACACTCATCGGCGGTTTCTTCTTCTTGTCCTTGCGCGAATGACCATCATCATCACTGTCAGTCCCTTTCATTCGTGCGAGTCGCTTTCGC
TCAAGCGTTTCAAGACGATCCTTTTCCACCTGTGCGATTTCTTCTGGTTTTAATTTGCGTTCTGTAGCTTGTGCCTTTGCTTCAAAGGCAAACTCACGTG
CCATAACATCAAAATCATCCAATTCCGCCTTTTTAGCAGAAGGAAAATCGTCCATCTGAGGAGTGTTTTTATTCGGACGATACTTTAGCAATGAACGAAT
CGAGTCAAATCCTCCATCCAATTCTTCCGTCACATCTTCTTGGATCTGTTTGTTACGTTGACGTTCCGCTTTAAACATCTTCGCCTTTAGCATAACTTCT
TTCATAATTTCTTGATGCGATTTTGGCTTATTGTCATCTTTCTCTTCATCCACATTTCCTCCACCAAAATGATACTTTTGTACAATTTCTTTCTCAACTC
GTCGAATCTCTTCATCTTTTGGATCATCACCATCTTCTCCATTCTGATCATTATCATTATTCAGACGATTATACTCATCATCCAGTTTGGTATTTTTGTG
TGTCAGAAATAACTCATCCTCTTCGTCATCAGACTCTTGCAAATTGTATCGATATGCATCTCGTAATTTACGCTTCCGTTCCGCTCGAAATCGAGCCATC
ATCTTTTCCTCCAATGATAATGACTCATCTTGCTCACCAATTCGACGATCTTCGAAATCATTGCCCTTCGTACGACCTTGATATTGTTTTGCAAGTGTGT
TCTTTCGCTTTGTTTCGGCTTTGGAGCGTGCATTCGCAACGTTTCGATTCTGTCCTTTTACTTTGCGACCAAGGACCGGATATTTTTGCTTTCTTGCGTT
ACCTTGTCGATCAAATGGATTGC