Description :
From Genome Similarity Track
Location :
Scaffold_1891:2196- 3218
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_1891-abinit-gene-0.5GI12967

Sequence
1022 bases(100 bases per row)
CGCAAGATGAGCCAGGAGTTCCCGCCGACCGCGTTCTCGTTCCACGTGCAGGCGCGCGTGCTCTGCGTTGGCATGGCAGTGGTCTATCGCGTCGCGATCA
CAATGACCACCACTACGACGTGCGTGATCGCGCAGCAGTCGAATAGTGCCAATGCGCCAGTACCGGGCTCATCTTGCCAGGCGTGGGTCATCGCGATGAG
CCAGTCCAAGTTCCGCACGTTCTACTCGCAGGTGCGCGCGATCCTGCAGCAGCCGGCGGTGAGCGAATACCATGCGCAACGCAACGACAGCGGCAGCGAC
TGGAAGCCCTTTGAGCGCTTCCTGCAGATGCTCACAGACGTACTGGACCAGTACGAGCACCTGCAGACTGCGTTTGCGATCCATGCTGACGTCGAGACGA
TGAACGAGGGCAAAGTAGCGCTTGAGGCGTTTCTCACTGACTGCTGGAGCGCGCTGGAGATCATTATCCCGTCGCTCGCGGTGGAGCCGCATTTTCCCGC
AGCGTCACTCGGACGCGAGATCCTCTGCATCTACGTGCTCATGCGCGACTTCTTGGCGTTCCCCGAGTGCATCCTGGAGGCGAACTGCATCTACGCGAGC
GCGATCTTGAGCCTGGAAGACGTCGAAGAGCTGCTCCCGACGCTCTCGGAGCACGCGTGCAGTATCTGCCTCGAGCGACTGACATTCACGGCCACGCGTG
ATCTGGACCCAGCGTCCTCTTCAACAGCAACAGTCACAGCTACCGCTGCTGCTGCTGTTGCTGGCGGTGCTGCCAATGCTCATGCTGATGGCAATGCGAA
TGACGCGGCTGCGGACTGCGTCGCTGCGATGGCTGTCAAGGAGGAGAGCGCGTTCTCGGTCAAGCTGCCGTGCGCGCACCTTTTCCACGAGAACTGCATC
ATGGCATGGCTGCGGCACAACCCCACGTGCCCCGAGTGCCGTGCGAGCGTTGGCGTGCGGTGAAGCGCATGCCGCGCCGCATGCATGGTGCAAACGGACA
ATAGGTATTAGACAACAATGCA