Description :
From Genome Similarity Track
Location :
Scaffold_177:21951- 28181
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_177-snap-gene-0.16CofD
Pytve_DAOMBR484maker-pve_contig_177-snap-gene-0.23SET binding factor 2

Sequence
6230 bases(100 bases per row)
CTGCGGCGGCGACTGCCGAGCGGCGAGCGCTTCATGTCGGCGGACGAGCTGGAGCTGCGCGAGGACCCGCGGCGCATCGACGCGGTCGCCATGATCCTGG
ACGACGTGCTGTACGACCACACGGGCCAGCTCGCGCACTTTGCCATCGACCGCGGCATCGCGCAGTTGCTGGCGGAGCGCGCGTTCCCGACGAACGCGGC
CGCGTTCGAGGCGCTGCAGACATTCCGCGACGCGTTCGGCCTACGCAAGCGGTTCCCGCGGTTCGTCGATCACTTGGTCGCGCAGCAGAAGCTCTCGGCC
GACCAGGCGGCCCGCGTGATCGCCAACTACTACGCGAGCAAAATCCCCGAGGCCAGGACCATCAAGCCGTTTCCCCAGGCCAAGCAGACGCTGGAGATGC
TCCGTGACGACGGGTATCGCCTCGGCCTCGTGCTCGTCGGCAAGCAGGAGGTGCAGCTCGAGCGGCTGCGCGCACTGCAAGTCGAGGACATGTTCTCCGA
GATCGTCTTCGTGCCCGCCAACCCGTCCGTCGATGTGCTCACGAAGGCCATGAAGAAGCTCGGGCGTCGGCTCATGCTGCAGCCTTCGTCGATTCTGTTC
GTTGGTCGCAAGGCGTTCTACGAGATCAAGGCCGCCAACCGCGCTGGGCTCGTGACTGTGCGGACGGTACGGCTGCTCCACGTCGCCGCATTCACAGTCT
CAACGTTGATTGACCTGACTTGTGTCTGTTGTTTGGTGGGATCGTCCAGCTGTTTGGCAAGTACGGCAGTGTCATGCCGACAGACTCAATGGAGAAGCCC
AACTATCAGGTGTGTTGCCACTAGTTTCCACTTTATGCGATGGTATCATCACTGTAGACCTCTGCGTGCTTCTCTAGATGGAGTCGATCGAGCAACTCGT
ATCGATCGTCAAGCTGGCTGACCAGCACCTGATCAAGCCCAAGATCGTGGCCATCGGTGGCGGCACGGGACTCGCCGTACTGCTCAAGGAACTGCGGCAC
TATCCTGCCGACCTCACTGCCGTCGTCACAGGTGTGTTTGTGCAGCAGCATCCCTCATTATAGCACTGTCGCTCACACCGGTTTGTCTCTGGGTAGTGTT
TGATTCGGGTCGCCACTCTGGCGAGCTTCGCAAATACCTCGGCATCCTGCCTCCTGGCGACATCCGCAACTGCTTGGTGGCGCTCTCCGACTCAGGTACG
CTTCCTAACATTCATCACATACGAAACATTGACGGATCTGACATTGAGTGACACAACAGACGAGCTCATGAGCAAGCTCATGAACTACCGCTTCCAAGAG
AACTTCATGGAAGGCTGCAGCCTGGGGAACCTGCTCCTCGCGGCGCTGACTGACATCACTGGCGGGTTCGACAACGCCGTGACCTCCTTGTCCGACATCC
TCAACATCCACGGCTCCGTGTACCCTGCCACGCTGGACAGCACAGAGCTGTGCGCCGAGCTAGAGGATGGGTCCGTCGTCGTCTCGGAAGTCAACGTGCG
CAGCCCAACCGTCGTCGACCCGGAGACCGGGAAGGAGCGCAAGAAGGCTCCGATCAAGCGCGTCTTCCTCGAGAACCCCGAGGTCGAAGCTTTTCTCCCG
GCTGTACGAGCGATCGAGGACGCTGACATCATCGTGATCAGTCCCGGCGGGTTCTACACGTCGATCATCGCAACACTGCTCGTGCCAGGCATCCGCGACG
CCATCAAGCGGAGCGCGGGAGCCACCGTCTACATCAGCAACGTGGCGACGCAGTGCGGCCAGACGGACGGCTACTCGCTCGCTACGACACTCGACAAGCT
CTACACTTATCTTGGAGCCCACGCGATCGACTATGTGATCGCCAACAATGTCGTCCCGTCCCCGGAGGTCGTGCAGCAGTTCTTCGCCCGCGGAGAGGAG
CTGCTGCTCCCGACCGACGACATGGTCGAGTCGTCACACCCCATGTTGCTGCAGGGCAAAACCTTCCAGGACGTGGAAAGCGAGAACGGCCGCGAGTGGA
ACAAGGCACACATGATCAGGCACAGCGGCAAGATGGTTGCCGCCATCTTGTACCGCGTCATCGATCGCGAGCTGGACGAGATGAAGACCCAGATCCGAAG
CGGCGGGCACTACCGACGGCGAGCGGCGAGGTCGACCAGACCGTCGCCAGCACGACCACGGAGTCCTGACGATACCGCGCGAGACGAAGGCGGTAACCGT
ACCTGGTGGAGCCAGCGTCGGTCAGTCGTTGGGCCAGCGCTTGTGCTAGGTGCTCTGGTCGTCTCGATGACTCTCGTGCGCGGAATGAGTGCAGGGAGGA
GATAACGCGACCAGATAAGTGTTGACAAAAGATATTTGATTATCATCTTGCATGCTTCTTACTGCTTCACGAGCCCAACGACGACCAACATCAAAGCACC
ACTCACTGCTTTTTCACGCGGTGAGACCGGTGGCGATCACTACTCGAACTCGACGACGAAGATTTGGACGACGACGACGACGACAACGCCGGCGACGCAA
GCTGGCCGATCTGGTCCTCAAAGCCGTGGAACGAGACCATGAACTCCGAAAATGCCTGTGTCGCGATGAAGAGCGTGCGAAACTCGCGCATTTCGGGTGG
AGACGCCGCCAGATAACTCGCCTCGTCGAAGAACACCGTCGTCTTGTTGGCGTTGTACTCGTCCGTCCAGACGTAGCGGTGGTAGCCAAAGTCGCCGATC
AGTGTTCGCACGGTCTGGTAGAAAAGCGACCGAACGGTGATCTCCGGGAACACGAGCGGCTTGCTCGGGAAGTGGTTGGCGAATACGTGGTCGCTCTGGC
TCACGTTCGGCTTGAGACACTCGTACAGCGCGTCGCGTAGCTCATAATGCACCTTGTCGGGCAGCGGACACGGGATCGCGCCGCGAAGGACGCTACCCTT
GTCCAAGTCTACGATCAGCAGCTCCTCGGTCAGCAGATCCTGCATGGTGGCGTCATCCAGCGAGCTCTTCTCGACTCCGAAGATGAACGGAGTCGGGCAC
TCGAGATACTGCAGCATGCGGCGCGGCAGCACAGGAAGATACACGTGCGGCCACAGCAGCGGGTACATGAGAGCGCGCAGCGACTCGCTCACCTTGAGCA
GCACCGACAGGTACGACGAGATGAACAATATGCGGCATTCGAAAAGAGCTGCCGTGAACACAGTCAGCACGGTCGAGATGTCCAGCGTGTCGAACAGCAG
CCGAACCGAGTGGTCCAGGCGTGGCAGCGTCTTCAGTATCACCGACGTTGACAGTTGGCCACCAACGGCTGAAGCAGATAGCGACGCTGCCGACGCAAGA
GACGGCAGGGGTGACGATGGCGGCTGGTGGAACGTCGAGATGTTTTCCGCCGAGATCGATCGCGCGATCTTTGCCAGCACCTTCTTCTCGACTTCGAACG
CACCGCTGGATGCAGCCAACGACATATCGTTGCTTGACAATGATGCTGCGGCTGCCGCGTTCGTCTCGAGCTCCAGGATGAACTCGTACGCCTCCGAGAG
CCGTTCCCGCAGCAAGTCGACCAGTGGGAACTTGGACACAACGCAGACTCCGTATGGGACCCATCGGCAGCATGACGCAGCGTCCAGCTTGACCGTCTCC
AACTGTTTGAGCGAGAGCGGCGGCGCAGGCTTGTAGATGAGGATGCAGGCTGCGAACAACTCTGACGACGACGAGCTGTCGCCCATGCGGAAGTTGAACG
CCATCGGCGGCGGACACGTCGGTGCGGACAATACCACCTGATGTGGGTCGGTGCACCACGGCACCAAAAAGTTCTCGATCGACTTGTCCACCACCATCGG
ACTCGGGTCGTGCGGCAGCGGGTGCTGAACAACACGCAGCTCGATCGTGTCGTCGTTCGGTGACGGCGCATTGTCGGCGGCAGCTTTGTCGCTCGCAGCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGGGGACATGGCCTCAAACGTGAGCACGCCACAAATGGCTTCGAACCCGCGCGCAGAGTGCAGCACAT
CCAGCGAACGCTTCCGCAACGCCTCGCGTGACGAAGGCTCCGGCCAGTGGTGCGCGCGGAGGCCGTAGCTGAGCAGCAGCGCCGAGAGCCGCATCGTGTC
GTCAACAGCATCGCGCTCGTCGTCCGAGAACATCTTGGGGTAGAGTGCAAACTCCGCGTACGCTCGACTCGTTAGGAAGCGGTGGTACAGCTCCAGGTGG
ATCAGGCTGAACTTGGCAATGATGTTGTCTTGCTCGGCCTGGAGCCGCGCGCACGAGGTCGTGAGCGACTTTTCCAGGTTCCGCATGTCGCGGTCGCCGG
CGTAGTACTTTTGCGAAATGTACTTGAGCAGCTTGCGGCACTGGTACGCAGCCTGATCTTTCTTCTCCTTACGCCGTCCTGGTGTCTTCAGCAGGCTCAT
GTATTGCCGGTACGCCGGCTTGAACTCGTACTCGACGTCGAGCCAGAGCGCGATCTCTCGATGGTAGTTGTGCGGGAACAGGAAGATCCAAAAGAAGTTG
GCGAACCGATGGTTCATCAGAATATCCTCGAGACAGATCACCTCGCGCTCGACCGTCTTTCGCATCTCGATGTACAAGTCCGTCTTGCGAAACTCAGGGA
AGCTCTGCATGAGCAGCCGCTTGACCTTGATCGCGACGCCATCGAACGTTCGCAGCGCGTCCTCACCGCCCGTGGCAATGTCGCGCTTGATGGAGCGCAA
CATGTCCGAGTCGACGAGGTCGGCGCCGATCGGAAATTGCGAGTTGCGCGCAAGATACTTCATCGCAATCTTGACGCCGTAGGTGCGCAGCATCAGCACG
TCGTCTTTGGTAAACGACGGCGGTCCAACGGTGCCAGGCCGACGCTGGTAGTTGGCGCGCAGCGTACACCAAAACTGACGGTACTCTTCGAACGAGCAGA
GAAAGAAGAGCTTGCTTTGATCGGCAGGGTCGGACAGCCAAGCCGCGTAGTACCGCATCATGCGCGGGTTGCTGATGACCTCCTCGATCGAAATGAGTGT
AGTAGGGTCAGGGGTGGGCGGACCCCCACCTGGGTTGGTGACGAACCCGGCTGGCGATTGTTGACCACCAACAAGATACTCGTCCTTGAACGCGCGCTGC
ATGACCTTGCCGATGTTGTTCTGGTACTGGTCGTGGACCCACCGGTTCCACTTCTGTAGCTTGGCGGCGCCGCCCGCATTGTGCGTCCCGAGCGCCGGGC
TACCGTGTGCGCCATTCGTGCCGCCGTTGAGCTGCGCGAGAATCGCCTTTTGCTTGTCGGCCCACTCGGTCATGGCACGCGACGGCGCCGCCGGAGCATA
CGACCCGTTCGGTGTCGTGGGAGCATTCACAGCCGGGTTGGCAGCCGTGGCTTTTCCCGCCATGGTCGAGTAGAGGAAGTTGCGTGCCTTGAGCTTGACG
TGCTGAGCCCATCGCGACTTGGCATTCTCGAGCTTCACGTCTTCCTCCTCTTCATTGATGCTTGTCACGGCGATGCTTCGAATGTCTTCGTCCGTCGCCG
TAAGCACCTCGGAGAGTTCCCGCACCGACAGCTCGCGCTCAGGTTCAAACAGCTCGGTCTCATACAGCATTTGTTCCGAGATGGTCGAGCGGCGGAACGT
GCTGCGGCTCGAGAATGAGAACGCGAGTCCGCTGTCGCGCGCCCCGCGAGAGTACGCGAGCGTCGTGGAGTCGCGGTCCGAGCGGCGCGGCAGCGTGAAG
TCGTCCTTGTCCGTGTAGATGGACGAGCTGAGCGCGCTCGCCATGCTCTCGCGGATCACTTCCTCGGCCGAGATGGTGCTGTCAGGTGGCAGCGGCGGGC
TCGTGTCCAGCGTCGCTGCTCACACAAACACCCCATGATCACACATATAATGTTAGAGCTCTGTCGCATCAAGGATATGAGACTGATGCAAACTACTCAC
AGTAGCGATCGCTGGCGGCACTGCTGCGGCGACTGTTGCTCGCGAACGAGTCCCCGAGCATGTTGCGCGTGAGCTTGCCGCCGTCGTTGAGCAGCGCGTC
CATGTCCATCGTGGACGAGTCGAGCGAGTGGCGGGATCCCGAACCGGACGAGTCCAGCTCGCGCATGAGGAAGCTCGCGTGGCTGCGCAGCGCCGACGCC
GACACGGGCACGCCGGCGCCGACGCGGGACGACGAGAGCTGCACGTGGTGGTGCGCTCGGTCGCTCGGCGTCTGGTTCGCCGACACGCTGCGGCTCAGCT
TGGCCTCGAGGACCTCGCTCGGTCGCAGCG