Description :
From Genome Similarity Track
Location :
Scaffold_990:2195- 4741
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_990-fgenesh-gene-0.0Liver stage antigen
Pytul_var.sporangiiferummaker-pug3_contig_990-fgenesh-gene-0.3Glutamine cyclotransferase

Sequence
2546 bases(100 bases per row)
AAACGAAAACTCAACGATCAGGCCGTGACGATCCATGAACTCACACTGCAAGAAGACAGCAGTAGCTGCTCGGAGAGTGAACACGATGACGAAGACGACG
TCGGTGCGCATCCCGACGACACCTTTTCCGTCGATGGATTCGAAAACCCGCACCCAGCAGATATGTACCAGTATACCGCACCTCGGAGAAGACAAACAGC
CTCCATGACAACAACCACAGCGGGACGGCAACAGCAACAAGTGAGTCGCCATACGAGTAGCTCCATGAGCAGCTACGATCACGCGACGAGAGGGCCGTCA
CCACATGATTGGATACCAACGACGACCGCCACTCATACTCGACATGACCAGAACGCCTTTGACGTCTCCCCGTATCGATCACCCGGAGGCAAGGATGTCA
ACGTCAAGGTACGCCGCGAAGTCTCCTTTTCGTGTCATCGTTATTAAATTCCCATCCGCTGATATGCATTACGTTGCGTGTGTGTGTGTTGGCCTATTAT
GTATGCTTCTCGTTCATTGTACAATCGCTTTCGCACCGTGGTGACCATCATTGAAGAACTTTGCCTGTGAGCTGTCTGCCATCCTTCCTGGCCATCAAGA
CAGCGCGCGTCGCCATCCATTCTGTTCTTCCTAAGCCCGTGTAGAAATGAAAGCCGAATCGTCTCCACATTCCAGCAACGCTCCTCCCCAGCAGACTGAT
TGCATCATTCGCACACGTTTCGAAGGACGCAATCCAGCACAGTTTGGGTTAGAGTATATTCATGATGCTCGCATACAGCAGTGATGCCACGATGAATCTT
CCAGCGCTTAAGATCACAGATTGGCGTCGACGCTTTTCGCGTGTTTCTGCTTTGTGTCGTGGTGGAGATACGACAACTCGAGTTCAAAGATCGAATCCCA
GAGCTTTCCAGTCACGTATACGTGGTTTGTGATTGGATTAAACGCGATGCCGTTCATCACTGCATCATTGCGCCATCGCGAACTCAGGATCGCGGGGGTC
TGCAGGTTCGAGGCCATATTGCGCACCCACGTGAGGTCGAGCACTTCGAGCACGCTGCCGTCGGTTGCGTTAATGCGCAGAATATGATTCGTGTACCACA
CGTTCGCGAGAATCTCGTTCTTTTCCGGAAGAAACTCCAACTCGTTGACGTTGCTGATCAAACTGCCGTCTTGTTGGCGCACGTCGATGCTGCGCACGAG
CTTGAAGTCGCTGGAGCGTGGATCGTAGAACTGGATCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTCCCGTCCGTCGTCATGCCCCAGCCT
TCCCCCGTGGACGTCTTAATCGGGTGCGTGTTCAGGAGCGTGAAGTTGGACATGGAAAGCTCCAGGATCTTCTTGGCCTTGTACGTGAGCGCATACAGCG
TGCCGCCAATGGCAGCGACGCCCTCGCCAAACAGACTTGGATCGAACCGGAACTCCTTCTGGATGCGTTTGAACGCACGGCTGCCATCGGCATCAACAGC
CACCTGTGCGTCTCCCGTTGCGCCAAGCGCGTACTGTCGAATGAACGATTTCTCATTCAGCCCTGTGGACTCGACGAGCACGCCATTGTGGAAAAACAAC
CCTTCGGTGAAAGCGTTGACGTCATGCGGATGGATCGTCACGAGCCGCACCTGCGTGGGGGACGAGACGGGGGCGCTCAACGCTGTAACACTCGCTGTTG
CGCTGTTGTGTATGAGCGCAAAGGCGGCAGCGAGGACCGCACCAAAGGTCCGCCACCACGGCGCATTTCCGCGCTGCGAGCTCCCAGAGGCGTGCATAGC
TGTTCAAATTAATCAGTCCTCTTCTTTTTTAAAACAGGTCGGCTGTACTGTACATTCCGGTTAATCAGGAGAAGGCGCAAAGTTCTCTTGTAAGAGAAGA
CACGATTGATTGCACATCGGTTAAAGTACAACTGTAAACCAGCTGAATTTTACCGAAATTTCTTTGACGTCTTACTGTATATTTCGGATCAAAGAGGATT
GGGAAATCTCTTTTACGTGAAAAGACTTAAGTGCGACATCCTTCCTTTAACAAATCGGCACCTGTCTCGGTGAACTGTCTTCAAACGAATCGACTGACGG
ACGAAGACCGAGACATCAGTCAGCCACCAGATCTTCCCGTGCCATCCTTGTGTGCAGTCGTCACTGGACTGGGGTTACTATTCTATTGTGGGCCAACGCG
CGGGTGCCAAACGTATCATGGGTGGTGTACCATATTCCCAGTCGCACATCAGGACGTTTGAGCTCACAGAATCTGCGCGGCGCCCACCTCAGGCCGCAAG
GCTCCACACATTACCAGCTGGTATTCGTATACGCGACGCTCTTCCCGCCTCTTTAGAGCAAGCTGGCGCCATTGCTAGGGGCATTACAAATATACTTGGG
GTTTGTATGCGTTTGGTGAATATGTTCTTGTCGACAATATTTCTGTGTGTGTTTGGAATTGTTTGCTCACTCGTGTTGCCGGGAAACCATCTGCCGATGG
AAGAAGGGAATAAGCCGGTCAGAGTGGAGTAAACAGTTGGCTTTAC