Description :
From Genome Similarity Track
Location :
Scaffold_13:219400- 224802
Transcript NameFunction/comments
Hyaar_Emoy2802430hypothetical protein

Sequence
5402 bases(100 bases per row)
TTTCAGAGCTCTCCGCGAGCTTGTCGTAGATGCTGTGCTGCAGCGTGATACCCATAGCAGGTGCCTCGACAGAATTCGCGTGGTAGAGCTTATAGAAGTG
GAAGGTAGTGGATGTGACCGGTCGGTAGCGTGTATGTCTGGTACACTCGCGGCACCCGCTACGATCAATGCCCGTAAGGGAGGAGACGAAATTCAAAACA
GGGGGAAAGCCCCCCTGGTTGAATCTCCAAGAGGGCACTGAGGAGGTTGGCTGGTGGGGTATTCCCGAAGCCAATGATTGGGCGGTGCCCGTCCGCAATG
TAGAATCTCCCATGTAGCCGGTCTTGATGCTCCCCTAACGTGTGCCGAAGTAGGACCATGTCTTAAGGAATCACGGCCCATGACTACTTGAAGATGTGTA
CTTCCGACTACGGACCACTCGGTCCTAGCCATTGCAGCACCACGATATTCTGGATTTGGTGTTCAGGTTTGGGCATGTATCGTCTTGGACAGGAACTGGG
ATGGTCTCCAGTACTTCATTACGTCGGTTAGCTCAGCCGCAGCCGTCGGGGAGTCGATAGAGCCTAATATCCTTTCCAGCTCATTAATCGTATCGCAGGC
CGTGAATAAGGAAAAACAGCCGATGTTTGCCCCCCCCCGCTCCTTCTCGCTTGCAGGGCTATCTTTCTGTCCTCTGAAACGCGGCAGCGCGTCAGGATGT
GTGCAGGGCTGAAACATTCAAGACAGGGGGTCTTGACAAGACGCTGAAAATGATGAATCATGATCACCAAATTCCCAATAACAATCGATGTGACATTGAG
GAAAGAGGATGGGCACCCCAAGCTGGAGAATATCACCAGCCAGTAATATTGTCGTTTATTCGAAAGCCCGTTCACACAAGTATGTCGTATGTCCAAGATA
TCGGACCATCAATCTGGCTGAGGACGGAATTCAGGAAGATCGGGTCGAACTTATTTGTTTCCAGAAATTCGACAGGATAATGTCGCGCCACCTGTGGTAG
CGTTCTTGTTCCCGGGACGTCGTTTCAGCCGACGCAAGGTTATGGTAAATTTACGCAGCTTGAGCTCTGTATTTTCCCAAACGACGGCTGCACGTTTAGA
CATAAAAAACGAAAGATAAGTTGTGATAGCCGTCAAAGACCACCCGTTGTGCTTCACGAACGAAATGATGCATCTTGAGCCTGTCTTCCTCAGTCCGTGC
TTGGGATTCACTGAGATTGTGTGGGATATACCCATCAACACGTGATTTGCCCAGGCAAGACATCGCCGGTATTTTTTCTATCAACGTTCCTCCGACCTGA
GTATGGTGAAAGGCAACCATAGGAGCTTGCTGTGGTGCACACCAAAACAGCGGGGGGCGGGAGGCCAGGCGGCGCTCCACGTAGACAGTTAAGACAACCC
GTTCGTCCGAGCCCATTGGTCGAAGATAGGAGTCATCGTGGAGTGGTTAGTCCTTCGTGGCAATGTAAAATAACATTTGCTTGTCCGAAGCTGCGGCTAC
TGCAGCGGCAGCGTTAGAAGCACCAGTCTCCTACAATCGTGCTGCACCCACTGGTTTCCATACTGGACGAACTTGGCCGTCTGCGATCACGGCGCGGGTA
ACCACTTTTTCCTGAAAGCCATTATTGTTAACTTCCGTGCTCATTTCACTGGCTGTAGTGGCCAAGTTATCCTCCTCGAAACGGGATGGTGTCGCCGCCA
TCTCTGAACATCTTAGCGCGGCTGCGGCCGGTAAGAAGAGATAATCGTTCGGGGATCCGGTGGGCATGGAGGGCGACTCGCTCGCGTGGATCTGTTCCCT
CCACTCATTTTCCGTGCTGTTATCGTATTTAATGACTGGGAGGGCTGGGTTTTAACTTCACTAAAGACTTACTACGGTAATTTGAAAAGTATCCTTGAAG
TTCAAGTACTTGGGTGAAACTTAAATTACCGATAAGAATTACTATTCGAACAGCCGTATCATCTACTAAATGAGACACACATCACCTTGAATTTGTACAA
CTTGGTCCATGAAATCGAATCGTACTGCTGCTATGCAGTACAACATTACCTATCATTTTGGTATCGAGGACCGGAATTTGGTGTTCTTTTTTAGCATCTT
CTTCGACCGCTTGAGTTCTATTTCATGGACCCATACAACGTTAGTGCTGACGTTGAACGAATGTTTATTGTTTCTTATAGCGGCGCTAGTGTTTCAACAG
ACAGAACCTGCCAAATAAAATTATGTCGCTCTCAGACCCTTCTTCTTTTTCCCAGAAGCTGTGGGCAGCAAAAAATCAGCATAAACCAATAGTAGCAATG
TCCCCCTTGACTGACTGATTAAACACACCTGTGAGGAGCAAAATTGAGGTTTTTGCAACCCGGAAGGACTTTGGAGTGGGTATGTGCGTTTTCAACCTTT
GGAGGAACAGGACAATTCTTCAAAGAATATACAAAATAGGCTCCACTCTCAGAGACTCAGGCTGTGGCATTAGACGATACTATACGATAAAAGTTGTTTA
TCTTTCCTTTCGGACAAACAAATGTCCGACCTATGGAAGATATAAACTTAATTGTTTTGATCGGCATGGTGTCCTATTTGTTGACCAAATTGCATTCATT
TGTTCACCAAAACCTGGCCTCGACGAGGTATGACGATCTACGAGAAATACATAATTTACACACAGTTTTCATTGATTCGACCGATAAGAAAATCTCAATG
GCGTCTACTTCTGTATAGATCTCTTTTGTATGCTCCCTAGCTTGGCAGCTTGCGGTATATATTAAACGGCTGGATTGACTAGCATCGATTACGCGAGCAC
AGCGAGCAAGCTTTTCTAATAATTTTCAGTGATAACATCATGATGTCATACAGCCTGCCAACTTCGCTCAAGCGGAGGTAAGCTATTTGTTCATACAAAA
GCCTAGCCTTACGTTGAAATGTGCAATCACGAGACACTCAGTTAATGATTGATCAATATGACCTGGTTAATGCACTTCCGACATTATAGTTATGTGATCG
CACTTCCTAATCCCTTGATAACGCGAAGGTAAAACGAAGACTAAATATATTTTGAGGTTTAGTCAATGTGTCGCATGACTTACTTTGCCCCATTCTCACT
TAACGGGCCGACCGACCACCAACGGTGGGGAGTATTCTCAACCTCCTTCCTCTACAACGACCTGATCTACCTACGTCTCAACTCCGTCTCAGCTTAATCT
CAATCAGGTCTCGAATATGCATTCCAACACGCCCTCCTCGAAGAGCACTCATTGATAACTCTGAAGCTCCTGCTTCGAATTGACACAGTTAACGTCGAAG
GCGCTTTTTGTCGAGAGGCTTCATAAACATGTCCGCTGGGTTGTCGTCGCTCTTCACCTTGTGGAGCAAAATTCTTCCTTTTTCAACTTGCTCACGCACA
TAGTGCCATCTCAATGTGACGTGTTCGTCGGCTTGAAAATGGTGGTGTCTTCAAAGTGTCAGATCTATTGGAGCGACAAGCACTCACACCGAGGGAAAAA
CTTTTGTGTAACAACACGAAGGCAGACGGGGTAAGATCATTGAATCTTTGGCATTAGCGACTAGGCCATACTTGCCCACAGTATCTGAAAAATGGCGGAA
AAAGAGGTGGTCCGCGGCATTGTGATTACCCGTCGCCGACAGGATACATGCGCTTTTTGTCATGTGGAGAAGCAAAATCGGAAGTCCCATTAGGAGACGG
TTTCTCGGGTGATCAAAGAGCCAAACCAAGTGGTTTATGCTAATTTGATTATACCTGGGAAGTTCAATGCAACTCGGTATGAGGCAGTACTTGTGATTAT
GGATGGTTATTCCTATTCATCACCGTTTACTTGATCAAACGAAAGGACAGAAAGATGGAGAATGAGCACATGCGAGAATATGTTCCATGGGCGGAGAGAC
AGGCAAGTCAAAATGTCGGCGGTAGTGCCTACATTGCAAAGCAAGTGCTCACCGACGAGGGCGGTAAGTTTGTAAATGGCGAGGTCTAGAATTGGTACAC
CTCGAAAGGCATTGATCGTGTCAAAGGTTGAATAGCTCGCAGCTCAATTGTGCGAGCGAACGTATCAGTCACTCGAAGGTATGCCTAAATTTAAAATGAC
GCTCGAGGGTTTTCAGACGAAACCTTTGGACAGAAGCAATGCAAAGTGCTGTGTACGTAAAAATCGCGGTTGCAATAAAGGCACAAATGGAATTTCGTGC
GAAATGATGTTCGGAATCAAGCCTGCATTCACCAAACTAATATATTTGGGGCACAGGCTTACGTTCATGTACCTGTCTCACCAGGACGGAATCAACATGA
TTCGAATGTCAAGATTGGTCACGTCCTGGGATACACAGAATATGTGGTCGGGTGCAAAGTAAACTTTCCTGATGCAGCTGTTGCTCAGTTTGTTTCAGAT
CTCAGCGTCGTCAAAAATATTTTATATTGAGATCGTTATGCAGCAGATGTGGACCAAGATGATCTATCTTCGCTTCACCTTACGCACCAAAACTCTAGTG
AAAAAATGCTACCTTCTGTAGACATTGATCGTTACACTGATGTTTACATGATCGGGGATGGTCAGACTGAAATCGAAGTAGACTCTGTACACATCACTAT
ACGAACATAACATCGGAGATCCACACAACTCCAACGCGAGTCCTGGTGCAGCCAATACGAATGAAAATGACTTGGACGTATGTGATCAGAATGGTGAAGC
CGACACGATTAATGCAGTAGATGACGACAAACAGTCTGTGACTGGTACATCTCGCGCAGATCCTAATATAATTTAGAAGAGGATGACGTCTGTGTACTGG
ATCTAATTAGCTCAGACAATTTGAATGGTGAAGCACCCAATCCGAAGGATGTACGATCTCTAATAAAACTGACCGGAAAACGCAGTCATCGCATTGATAC
TCCATCGGAAGTAGTACATCTAGAGCGTGGGGCACACGAGGCAAATTTAAAGAACACTCGGACTGTCATGCATGAGTACCTTGAACGCCAGCAACCGAGG
TATCTATATGATTGATTATGTGATGAATGTCGCTCTCACATCCTCCCATTTTTTGGATAGCAGCGGAAGACCTATTCACTCAAGCGCTATTAACACCCCT
CGAAGTCGTTGCGAAATGCTGAAATCAGTATGGAAAGAGTTCTATCTGGCGGCGGAATCAGAGGAAATGGCTGTGCTCAAAGCAAAGGATGTCAGAAGAT
GCACGTTTGATGAACACAATGTGGGCACACGCCCTTAAGACTGATCATCAGGGGTATAAGCTCAGATATAAAGCTCGCATTGTGGCCCTAGACCAGGAAT
TATTTTTCAAGAGACATTTGCTCCAGTTGCAAGAATGTCCTCGTTCCATTTACTTGTAGCTCAGGTAGCAGAACTTAGGTTATATTTGTATGGTGGAGAT
AT