Description :
From Genome Similarity Track
Location :
contig_7:21939- 24749
Transcript NameFunction/comments
g1990.t1hypothetical protein

Sequence
2810 bases(100 bases per row)
TATTCTTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGACTGTGTAGCCCGCTACAACAACAAATTCACGGTTCCCGGTCTAAGAAAACCGACTACG
ACGGTAGGTTTAAAGACTGAATATATTTTATAGGTAAGCCAAGCTTGATCCTTACAAGCTCTAAGTCAACTATAGTAAAGCTAAACAAGTGCCTAATGGT
TGGCTCACCGCCAACCGGTAGCACGTACCATGGGCACAAAAGAGAGAACATCCCGTCACTCTTTATGTAACATTGTAAAGTACGTGGAAAAACACATCAG
GAAGGTGGCTTCTTGGAACTGGTGCGTATTCTGTAATGCATTGTACTGATCAACTTCAGCGTCGCCTGTAGGAACTGCTAGAACGATGTATGTAACTTGA
ACATTGTAGGCGTCTCCCGACCATTTCATGGTCCCCTGGCAAATTTGACACAGTTGGGTGCGCTTGACGTACGCACCGGGACAGCACATATGAGCTACCG
TCTTACCCCGCACAAAGTGCCCAGGCGCAGTAATAAAATACTGCGCCCATTGAACACTGTATTCGTTTTGAGTGCCTAGGCATTGTACTACGAACAATAC
CTTCAACATAGAAGAACGGCAGCTCAGGTAGGTACCCTACAGCTAGAAATATGAGTCTGTTCCCTTTAACTTGTAATGTGCTAACGGCTCAACCGGTTAG
AGCATGGATTGTCGTACGACTAGTCCATGGTTCGATCCTGGGCGCGTCAATTGAGGGCCCAATATGGGAAGAGGGTTGTCGCGAGAAAAATCTCGTTAAT
GCTCCGCACACAAAAGGTATGTCAAACTTGTCAAATTCAATTGGGAGAAATCAGAAACTAACATTGTTTTGTTTTTGTATCGGCCTTTATCCTGCCTACA
CGAGGTATCCATCGACCTGAACAGCAAAAATACCCGCCTCCTCGTACGAGGAACACGTCCTTCGTTGCATTTTCTGCTGTGTAAGTGAAGCTCGTCGTGA
GGCGAGACTGGTCATCGACTGTTTGGAGATTGATGTTCCATCCGTGCATCTTCGACGCGGCATAGATCTCGAGCTCAGCTGGATCTGTATTTCCGTCTCT
GATAGCCGCGAGTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAACGATGGGCTAGGATCGGACGGGACCGGACGTACGATCGGAGGTTGATGA
AGGCAGACTTTGGAGGGATTAAATTGGACCTGAGGGGTAGGGGTATGGAGACCCAATGGGTACAGTGGCGCCATCAGTCATCGGTGTATACCGGTATGCG
GTATGGTGCGATCATTTCGATATGCGATCGTGGCCACCACTGCGATCGCGATCCCGATCGCAAATGGCGATCGTGACGTACCACTTTGGTGGTACCCGCA
ATCATTCCGGAGTAAAAGATCTGTGGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAAGGGGGAGGTAGGAAGCTGAGGTCATTGTTGCTTTTGC
TTGTTTGTTTTACCTAATAAGAGAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTTATTCCAGGCTGGGAAGTATATTGGCCCTCCTGACGAC
TTCGGACTCACCTCGTCGCGCAAGGTAATACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCAACCACTTAACCCCCCCCCCAGAAGACCCCGCCATA
GGAGGCGGCAAGCACGTAAAGGAACACACCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACGACCGACGACCGCGTGAAG
AATACCCGCGTGGCCGTCACCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCCTGGTAACCACCGACGCCTTCAGTGAACACCGGAAGAG
CGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCGCGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGCAGTCCGGGCGTAC
CGCTGGTAAGCCGGAGATCACGACAGCAATTTTCGTGATCCCGCTTCGCCACAATGGTGCGCGTGCCCGGATCTTCTGGTGATTCACAGGGATTTCACCG
TGAGTCCACAGAAGAAGACGTCAAAATCAAGATGGAACCAGGGAACGAGTCGTCGACGGAAGAAGGATCGCCGCCGACGGCGCTGAAAGCGCCAGGATCC
ACTGATCGTGAGAGTGCCGGGAGGAGCTCTGACGATGTGAAAGAGGAAGGTTCAGCGATGGACCTAGAAGAAAAGCCTCAAACCCCTCCCCAGGTCCCCT
CGGGGACCCCCGCGGATCGCGATGCGAATCGTGATCCGCCGGACGAAGGTCCGACGGTGAAAACCGAAGGACCTTCATCCAAAACCACTCCTCCAGTTCC
GCACGCAACCTCGAAGAAGAAGAAGTCGAAGCCCTCACGCAAGAAGCTGAAGGCACCGGAGTCTGAAGCCGAAGACCAGGAGGATTGCAACACGTGGACG
GACGAGCAACTGGAGTCTGCCTTCTTCTACAAGGACCTTTACAAGTTCCTGCACGAAGACCCTGTAATGAAGATCGTGCGCCCGAAGCCAATTGGGGAAC
TGCAAGGTCCAGTGAAGGCACCGAAGGAAGTAACCAGCCAACTCGAGGCGGTGAAACTGCTGATGCGCATGCTGAAAGAAGCGGGAATCGTGCTCGGCTC
CTTCGACGCGAACGAGCTATTCGACTTGGAATTGCCAATCATCAGGGAATCAACGCTGAGCCTGTTCGCGAAGCTGACGCCCCTTGTCGGTAGTGTCGTC
CCGGTTCAAC