Description :
From Genome Similarity Track
Location :
Scaffold_1388:2193- 3864
Sequence
1671 bases(100 bases per row)
AGGGAGGAAGCATAGCGTTGCTGTCAATTGAATCAATGAGAGGGCGTTCAGTTGGATCTAGAATTCTTGAAACCATAGATTCATGACTAGTTGCCTTCTG
GTCTCGTTCACGCATGTACTGTCGAATGATCTGAGTGTCTTGAGCCTTTTGCGACGTCATCTTGTTTCGTTTGGCGGTGTGGATCATGCCGAGCTCACTG
AAAAGCCGTTCAGTTGTTGCGGTGTTTACCGCAACTGATAGTAGTCGGATTGCCAAGTCCGGTAGAAAACTTTTCGGGTTCTCTTTCTTCACATGCTGCC
AAAACTTGATCTTATTAAACCGGAACTCACGTGGATGTGCAGAGGTCAGTGTGTTTTCGATCCAGTCCATAAGTTCACTACGAATACAGTCAAAATCATC
GCCAATAAGGCGACGATAGTAGAACACAGCAAATTTTGCGAGTTGCGTCGCCGACGCAATTTTTACAGCACTCTTGCAGTATTGGTGTCGCTGGCTTTCA
CAGCCATCTAGCCCTCCACCAACCCTTTCTTCCACCTCGAGAGCTCTCTTGCGCTGTTCAGTGCTTTCAATTAAAGCCCGACACTCGTCTGCAGTGACAG
GGTTTAACAGGAACGCCAGCATAATGAGAGGCTGCTCGCACTGCTGCCATCGGGTCTCCACGCACTCGATCACGTCGCCACGATAGTGCGACTGGACTTC
GTTGAAGCCAACAACGATATCCCGGAACGATACGACCACATCTGCCAAAGTATTTTCGTCTCTCTGAAGACGATATGATGCTTCAGATAGCGGGGCAATC
ACATTTTCTGCTTCCGACAGTTTTTCCCAAAATGTACGATCACTGAAAACGTTTAGTGAAGACGGAAAATCTCTATGCCCACGGTACTTACTTTCGAGCA
TTTCCAAAGCCGTTTTCACTCTTAACAACGAAGCAAAACAGCTTTGCATGCTGTTCCAACGTGTTTCGCACAGCGTGAACAGTGCTAGCGGTTTGGAGTA
GTATGCTTCCATCAGCGCTCGCGCTCGACAAGCCACTTTGCAGATGATGCATTCAAGCATTTCACCGCAGCAGTTGCATCTTTCGCAACATTGGAAAATG
CGGTCTTTAACACGGCTTTGACTATATTGTTAATACAGTGAGCAAAGCAGAAGATAAAAATCATTTTAGGCCATCGTAAAGCCAAAATTCGGCGAGCTCT
ACCACATTGACCGGCGTTAtcggttgctgcagcgccaacctTCCACTCTTCGCTGACTGCTTGAACCATAATTTCTTCCATTTCCTGCGCAATTGCAACT
CCGTCATGTCGGCTGCCAGCCTTCGGCAATGCATAAGTAAGGCTATTCCCAAATAACGTGAGTTGACAGCTCAATAAATGCTCCCGCAAGATGTTTTGCC
AGACATCTGAAAGAAAATTGACTTGACCCCCCGTCGAAGTTTCTACatgcttcaacttcttcacttgaACGTCACGACAGTGTGTAGCGTGGCTCTTCAG
AATGCGGCCACCTAGCACACGTCTAGACGGTAGATACGCTGAAACCCCGGGGCACAGGTACTCCAACAGCGCTATTGTGCACGGCCTCTCTACAAACGAA
TCAGGTAGAAAATTACCAGCCTGGAATTCAACCAATAGCCGTTCTAGCTCCTCCTTCTGAAACTTCGTGAA