Description :
From Genome Similarity Track
Location :
Scaffold_111:2193- 3590
Transcript NameFunction/comments
g7398.t1hypothetical protein

Sequence
1397 bases(100 bases per row)
CCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATGTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGG
AACTGCCGCAGTTCCTTTACATTTGAAGGCGTTGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACC
CAAGTACGGGTATCTCGGTCGCCCCGAAGATACATTTCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGT
ATGCATCGCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGC
GTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTTAGCCCCTGCGGCATTACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAG
GGATATCACTCTCACGCATGAGGATCTGAGAGAACCCGTCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCG
ATGATCACATCTTTTCGAGGCATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCT
TCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTTCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTC
ACGCGGCAGTGGCCACTGTCGCGTGACGCAGTATTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCGCAGGAATG
TCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGCAAAAGGGCCCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTT
TGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATG
CGTCCATCGTGCAGTTCGTGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCT
TGTATTGAAGACCAATACTCGTACGCGTCAAGACATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTC
GGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCC