Description :
From Genome Similarity Track
Location :
scaffold_79:21924- 24252
Transcript NameFunction/comments
Plaha_PHALS_11998Pleckstrin homology-like domain

Sequence
2328 bases(100 bases per row)
CATGGAAGGAATGCTAAAAAAACGTTTGGCTAAGATGCCAGTCATGCGCGATCGATACTGCGTGGCCACATGGGAAATGGACGTTCGCGGTCGCAAGTGC
GTCATACTTCGCAGCTTTAAGAGCCGTAAGGCTTACGATGTTCACCCCGAGAAACCCTCGAGCATTTACGAAATTAAGTGCATAAGTGATTGGGACGGCA
AGACCGGATTTCACCGTTATCAACACGCTTTCGCCATTGAAACACGTGATCAAAAGCTTTTTCAGTGTGTGGCACCGTCTGCAGTTGACAAGAACAAGTG
GGTCGAGCTCATGAAAAACCAATCGACTCTCCAGTCTCGTCGCGGTAAACGTGTAGTTAATAACGGGAATCTCGTAACGCTTCAACGCTCTCAGAGCGTA
GTTTCTTCATCGTACAGTGGAAAGCCTCGAACATACTCGAATGGTTCAGTGGGCAAGACGAGATGCGAGAGTACCGCAGATGCCGATCTCTCTACGGATT
CAGAGGACCAAGCGAAATTATCCAGCCATGATAGGCTCTTCAGGACCACGTCTAGAGAATCAATCACCTCGTCGGAGCTGCATCATGGTGACAAAAGTGA
GCCTGCGGACTGGGGACTTTACGGCGAGACTGACGATGAGATCAAGTCTAAGTACGAGGTCATGAATGATGTCAAGCCCGTGTTACTGGAGAATGAATTG
CTGAACGCGCATGGTGATACAAGGACATTGGCATCTGACGATTTtttgtttgaagaagcaggagCCAGTCGGTTTGGCGCTGTAGTTGTCAAGGAAGCTA
CTGAAAGTGACGACGATGATGATGCCGAGTTTATTGACGAGAAGTTTGCTGCTCGCGAGGCccaaaaagaaaatgagAAAAAGATGAAGCGACGTGCGCA
AAAACTAGAATCCAACCGCGACTTATACGCCGAAATGGCTGCTGCAAGACTTGCCAGCATGCGAAAGGATGCCCGTCACTCGAAAAAGAGCCATATTTCT
AATCGTCTATCTGTGGTTAGTGATGACAGTGACGTTAACGAGTATGATGAGGATCAGTCAATGGTTGTTGAAGGCGAGGAGATTGTTCATGTGGAAGACA
TTTCAAGGCGTCATAGCAGCCATACTGTTAAGAGTCGAAGAAAAAGCATTGCGAGCAGCAGTGAAAATAGTGATAGTGCTGACGGTAGAGATGTTGGTAT
CGTTGTTTTAGAGGAAGGAGAGGTGGAAGTGAAGTCCGTTGATGATCTTCATGCTACGGAATCAGAAATTGACGAGTTGCGCCTGCAGAGAAAGAAGATT
CGAGCAGAGCGTCGTGCAAAAAGGCGTCTTTTAAAGGAAAAGGAAaaggaaaaggaagaggagGAACGTACGACGATGGCAGTGGCTGAACttgctcgtg
ctcatcgcgAGAAACAGCGTCTTCGAGAGGTGGTCAAGACTCGTGAGGAACAGGAGAAACGCAGCAAGAAAGAGCGTCGTGATTTTAAAGAGAAGCTTCA
GCGAGAAAAGGCGAAGCAGCGTCAGGCAGAGGCAGAGCTTAAAAAATTGTTGGAAATTAACCAAGCGGAAGAGGACCGTCGGGAGCGAGAACGCCAAGAC
AGGAAGAATAGCAAGAAGtcgaaaaagaaagaaaagtaCTTTTCGCTTGCTGAGCGAATCCACAAAAAGGAAGAGCGCGATGCGCAGCGTCTGGATGAGT
CTGCAGTTGTTGCAGGTGTTGAAACTGAAGTATCGCATGCTTTGGTGGTCGTGGAAAAGCCTGCAGAACCAAAGCCAGCTAATAAGTTGCCCTCAGCTTC
AAAAGTGACCCTCCAACAACTTTCTCCGTCCGTCCAAACCGAAGCTTCCCCAGAGTTACATTCTGCTCCAGCTCCAGCCTTTCTACCTGCAGCAACTCCA
GCTTCCACTTCTACTTCTAATCTTGCAAcccaaggtgctgggcaagCAATTCCGATGTATCATGTGGTTCCGCCTCCTTTCGTGCCAACATATCCAGCCG
GTCTTCAAAGCATGCCAGCTTACGGGCTTGCAGCAACGTTCGGCGCTTATCCTCCATTTTATACTGCTCCTTATAGCTACGGAGGACCCGTGGGACTGCA
GTCTTTGTTCCCTAATATGGGTTTTATGGCTGGACATAGCGCTATGAAATCGTATGGTAAGCCCGCAGGCCCTCAGGCCGCACAAGCCAGTCAGGATTCC
GCAAAACCGATAGTTGGGCCACAACTCCCTACTCCGGAAGAACGTGCAGCAGCTGGTGTTAACGCACATTCCGTTCCAACCAAACTTATCAATTTGCCTG
AGCTGCCAGATGTCATCGAGTTTTAGAA