Description :
From Genome Similarity Track
Location :
Scaffold_275:21924- 23188
Transcript NameFunction/comments
Albla_Nc14112440calmodulinbinding transcription activator putative
Albla_Nc14112450conserved hypothetical protein

Sequence
1264 bases(100 bases per row)
GTTTGCTTCTACAACTATGCTCGATTCATTCCATTCTTGGTGGCTCATGGAGCTCAGGTGAACCAGCAAAACACACAAGGCCAGACCGCTTTGCATCTTG
CAGCAGGATGTGGTCATCAAGATGTCGTTCAAATCTTGCTCGAGCATCAAGTCGACCTGTTTGCGTGCGATCATTTGAAACTCACCGCGGCTGATCGAGC
CGAGTGTGCTGGCCATTTCGACGTCGCATTTCAGCTTCGACAGCTTATGAGCATTCATCCAGACGACGGATATCAAGCTTGTCAAACCAATGATATCGGG
GAATCTGCTGCGCTTGTATGACAACCTCGTTTGCTACTTCGATGAGACTAAGTGTGTGATTTAGGTCGGCGAAAGGGAACGCGACAACCGGAAATTTCTC
ATGGGAGCCTTCTCGGCCATGAGCTTGCACGACAAGTGCGCTTTATCGCTTGGCGTGTTGCGTGATCCCGAGCTTCAGTGCGACCTTGACAACTCGACTG
ATCTGGCAACGGAATGGATACCACCAGACGTGAGTACTGATCTTGGATCACACATCAGTTCCTCTACATCTTGGTTTCCATCGAGTACGCGAGCGAGACT
TTGCGATATGAGGAGTGTGATAGCCGACGATGAAGTAGGAAAGCATAAACTTGTGGCGGCCATGGAACTCATGGACCCAGAAGAGCTTCAGTGTCTTAAA
GAAGAAGCAATAGTGATTCAACACAACGTCCGTGCGTGGCTGCTCAAACGCAATTATTATCGCATGCGAGATACCACTCAGAAGCTTCATGAAGTTGCCA
AAAGTATCGAAATAGAACGTCGAGACCAATCCCGATGCAAAGTCAAGTCTGATGCTAGCTTTCCATTGTCTAATTCCAGCGAGATCGCAAGATTGGAACG
AGCAGCTGTCACTGTACAAGCCGCAACACGCTCAATGATCGCCCGAAAAAACTTTCTTCAAGCCAAGAATGTGACCATCAAAGTCCAGGCCGCGACGCGA
GGAGCACTTTGTCGGAAAAATTTCTCGAGGATGAAAAGGCAAGCGCTCGCTTCGCTTGTAATCCAGCGGAACGTCCGCGAGTGGTGGAACAAGCAGTCAA
TACCTTCACCATGACAGGGGGTACACCGATTCTCGTTCAGATTGATACCAAAGCTACTTATATGCTACTTAGTCATTGTACTCCTCACGGAGCTCAATTG
CTTGATCTTTTAGTCGAAATCCTTTGATCGGAGGCGTCCATGAAGGAATGTAGGAGCCTGGAGG