Description :
From Genome Similarity Track
Location :
Scaffold_535:2192- 3755
Transcript NameFunction/comments
Phyta_totarag9096hypothetical protein

Sequence
1563 bases(100 bases per row)
GNCGATAAGATCTTCAACAAACGTCTTTTGTTGATACGAGAAGCGTACGCGTACGACGCGCTTCTCTGTCTTCATGACGGCATCTGTTGCTAGTCGTACT
TCCAGTACGCTTCGAGGTGTTTGCATCTCCTCGAAGTCAAGGTCTAATAGACTTTGCTGTTGAACAAAGTTGTTCGACACACCTGAGTCTACTAAGGCGC
GACGAGAGCCCGCTCTATTCGACgtcacgtccaggatgacaaAGTTGGGCTTGTCATCTCGCCTGTTGCAGTGAGATTGCCTCTCACTGGGGACTGCAGT
CCNCATTGCGAACGTGATCGCAGCCTCGAGAGTACTCGGGTACTCTCGGAAGAGGTAGGTCTTCACAGGCCTATCCTTGAGGCTCAGACAAGCGTTTGAG
CCCCCGCAAAACGAATTCCGATCGAGGGCCGAGttcctcgatctgcagcagggcAAGCATTATGTCCATGCTTACGCCCAAAGGGCACGGTACTTGGTCT
CGAACATCGTGACCAACCCGATAGACGAGGCGATCAAggtcgtcacgttcatgaaggGCTCCTCCTTGAATGCCTcgtacgtgctgaagaaCGTGAGTCG
GCGTCCGTACGCCCAACTCCTTGCTCGGCCGCCAAGGCACGACATGGATGAATATACGCGTCTTTCCGATAGTACTTAAGCGGATTCCTTACAATGATAA
AATTAAAGGGTGCAAATCTTCCAACATTTATCAAAGTATACAAAATCAAATATAAGTTGGTATTCAGGGCTCTTGATTGGtcggaagaagaggacggatg
tcatcAAGCGAGCACGGCGAACCTGTCTGTGGTTtgacagcccgtgtgcgaagcacgcgaatacaaacccaggacccagcatggccttgtcatcaagcga
ggcgaagcgtgcgagccgtaaCGGtcttagggttctgtcaccagcgagcgcagcgagcctttatggtaggtgggatagcgcggagcgcgtagtAGGGTGg
tagtttaaagttgacacccctctcttttgcatgtttatgtaTGTAGGGAAGTGTCGAAACCGTTGCGATATGGCGAACGCAACCTTCGACAACGGTTCGA
CAACACGTCGAGCCGTAATAGCTGtgtcgacttcgacaagcCAACGGAGAAGTGGTTCGGCCTCTTTTCCCACGTAGTTGCTCACGTGGAGCTTTAGCGA
TATCGATCGCGGTGTCGTCggggacgacgccgtcgtcgatgcAGCATTACCTCGCTGTTCCTTAACGAGAAAGCACAGAGCAACACCGTTTTGCTCTTTC
GGCGATAGCGTGGGCAGCATCGCCGCTACAACCACCTCGGTGCTACAGCCGCCTCCCACTCTCGGTCAGACAGGCGGGGGCAGTCTGCACGCGCAATGTg
tgttgcagacgcagttggGCTTCTGTCCATCAAAGGGTTCTCTCGCCCATGTTCGTAAGACTCCATACGAACGTGTAGTTAGTCGGTCGTTGGACGGACT
ACGAAGTGCTAACAAATGTATTGGGCCTACTTAGTCCAATACTAAGCTTACACATGAGCGCAC