Description :
From Genome Similarity Track
Location :
Scaffold_20:219196- 220348
Transcript NameFunction/comments
g8200.t1hypothetical protein

Sequence
1152 bases(100 bases per row)
GGACCAGCCGACCAACCAGTCAGTCGTCATCAGTGGAGAAAGTGGCGCCGGCAAGACCGAGTCGTCCAAGATCGTGCTGCGTCACCTGACCACGCGCGGC
CTGTACGGCAAGAAGGCGCGCGGAGACGAGATCGAGACCTTGTCTAAGACTCGTCAGCAGCACGGCACGTCGCTGGACCACCGTCTGATCGAACAGAATC
CGATCCTGGAAGCGTTCGGCAACGCAAAGACGTTGCGCAACTACAACTCGTCGCGTTTCGGCAAGTTCATGAAGTTACAGTTCACGTCGGACGGCGAGTT
CAAGTTGGCCGGTGCTCTGGTCGAGACGTACCTGCTGGAAAAGTCGCGTCTCGTGTACCAAGTGGATGGCGAGCGCAACTTCCACATCTTCTACCAGTTG
CTGGCCGGCGCCTCGGCTGCGGCTCGTAAGGAGTTTGAGCTGACGAAGCCCCAGGACTTCTGCTACCTGAACCAGAGCGGCTGCTACATTGCCGAAGAAA
CGGACGACCACGCGTGCTTCGAGGCTGTGGTGCGTGGTCTGAGCTGTGTGGGCATCGACGAGCAGGTCCAGCACATTATCTTTTCGGTAGTCGCGGGTCT
ACTGCATCTGGGTAACATCGAGTTTGAAGAAGAAGATACGCCCGAGGGTGAAGCTGCCGTGATCGAGAAGGAATCTGCCAAGCGAGCAATTGTTGTGGTA
TCCAAGCTGCTGGGTGTGAAGGAGGAGGACCTGTGGAAGGTGATGATGACGCGCGACATTGTGACGCCCGAACAGACGTTCACTGTTCGCCGCAACGAGC
AGGCTGCCGTGTATGCACGTGACGCTATCGCCAAGGCGCTGTACAGCCGCTTGTTCGACTGGGTTATTAAGCAAGTGAATTCGTCTCTGGGCCACGATCC
CAACCCACTGCCTTACATTGGCGTGTTAGATATCTTCGGTTTCGAGTCGTTCCAGCGCAACGATTTCGAGCAGCTGCTGATCAACTACACGAACGAGGTG
CTGCAGGCTACGTTTAACAACCAGGTGTTCATTGCCGAGATGGAACTGTACAAGCGTGAAGGTATCACGGTGGGCAAAATTAAATGGCCTGATAACCGCG
AGTGCGTGGATTTGATTGCATCCAAGCCCAACGGTATTTTGGCTTTGCTGGA