Description :
From Genome Similarity Track
Location :
Scaffold_214:21919- 23103
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_214-snap-gene-0.13Hypothetical cleavage induced protein

Sequence
1184 bases(100 bases per row)
GCGGGCCACGATACTGCGGTTGATCCCGTGTACATTCCACACCGTTGGGGGTAGCAGCGTGATCCACGTCTTGTGAAAGTACACCCAGAATGCCCGCCAC
GGTTTGGCAGAGAACTTGATGCCTTCCTCACCACACCGCTCTCGAATGCGCGCCCGAACCCACGCAACGCCGTTCTTGGCGATCGTGGAGTGCTCAGAGA
CCGTAAGCATGTCCAGCACCCCCTTTTCCATGGCAATCTTGATCTCGGGCTTGGAAATGCGCAGCTTAGCCATCTTCCGTGCACAGGTCTGCTTGAAATG
GAAGAAGCAGCCGACCACATCAGCGTCAGGAAACCAATCTTGGACGGCTTGGATCAGCGCGAGCTCGAAGTCGCAGACGATTTGCTGAGGATCGATTCGC
TCGCCACACGCATCGCTGATGTACTGAAGAATGTTCCAGTACGCCTCGTACGTCTTTGAAGCCGCCAAAACGTAGAAGACAGGCACGTACACATTGCTCC
CTTGGTCAAAGACCATGAGCACCACACACTGGCGGAAATTGGATGGAACACATCGGAATGTGCCGTCGATGAAAAGAGATATCTTGTTGTACCGAAGTAG
TCCCAATAGCGCTGGATGCGCCCAGCCGATGACTCGGTCGATCTTGTACTCATTCTTCACCTTGAGATTCGTCCACACATGGTGGAACTGGAAGAAGTTG
AGCGACGTCAGTCGCACGCGGGAGAGCGGGGGCACTTCAACACGACCGTGGATGTCGGAGCCAAAATGCTCAGCCCGCACGCGGTGGACTCGCTTCGTTA
CTTGAGTCTTGGACCTACCACGGACAACGACATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACATCGCATCCCAGATTGCCTGTGGCGTGTCG
GCGCTCGTCACCGCCATGCTGTCGACCTCGCGCTGCATGGCTGCTTTCACGACCAGCGTCTTCGTCGCCTCGTCGGGTTGCTGATAGGCCTGTGATGGCG
GTGTGCACGTGTGGGGGATCATATTGGCAAAGTCGTAGTCCATCGTGGAGGCGTAAAACACGAGCTTCGCTGTGCACTCCTGGCTGCGGTAGTAGCTGCA
GCGATAGGAGATCTTGACGCGCGTGATCGTAGCTCGCGTAAACTCAAACCCGCGGACGTAGATCTTGGTCCGACCGTCGCGTTT