Description :
From Genome Similarity Track
Location :
Scaffold_53:219176- 222139
Transcript NameFunction/comments
Phyin_T30-4PITG_17269Putative uncharacterized protein

Sequence
2963 bases(100 bases per row)
TACTCGCCTTGTAAAACGCTTCTGACCACCGTTGCTTTCGTGTCAAGTGCCTACCACGCCGTTCATCATAAGGAACTATCAAAAATGGCCAAATCTTAAA
CCCAGCACCACCCAGCCAGTTGATTCCCAGCGGACACAAATGACGGGCACGAGCACCAAGGATCTTGGATTGATTCCACATGGATCGATCGGAGTTACTG
CCACTGAAGACCCCAATATATCGAAACTTGTTGCGATGATCAATGGTAGCTAGACAATTGTAGGAGGGCTTTCCGCTTTTGTCGTAGAAACCCTGTAGGT
AGGGAATTTTTTGATAGTATTAGTCATTGCAGCAAAAGAGAGGAGATCAGCTTACCAATTGCTCGTTGGGCCTTCGGGTACGTACGAGAGTACCGTCGAA
AATGCACGCAACATCAGAACCCCCCTTTTTGGCAAACCCCTCTACCATTGCATCCCATTCCACGGTAGCCGTGGGTGCAGGAAAATATACGACGTCATCC
AGCATATCGTAAAGAAGTTTTTCAATGTTCTGGATGTAGCAAAGAGCTGGTGTTCTTGACATGCCGAGCTGAGTAGCAGCGCCGCAGATCCCATCGCCAT
CTTGCCCGCATCCGTTTCCGTAACAAGTCAGCAGTGCTGCAGGCCCGTACCCAAAGTTGTACTGCGTGTTTTTGCCAGGAATCCCATATTTGCGATAATA
ACGTGGCTCCAATAGACGCTCAAGAGCGTCGAAAGATCGTTAAGAGCACCTTACAGTTCTGCGGTACGCTGTCAAAGATTGTTTTTCCCTCAGGCGCAGA
AAGAAGTCGGTACAAATGACAACTTCTTCTCCATCCAATTGGCTTAATAAAACCGTTGTCACGATGAAGAAGAGAAGGAGCACCAAGATCTCCTCGTCCG
AAATTCCGTCCGCCAGCGTGGATGCTCTGTTTACGTTGCCAATACCCTCGTCCATTAGTTCAATCTGCATCTCTTCATCTTCGCTTGATACGGCACCAGC
AGTAGCAGGAAACAGCTCCAGCTCTAGTTCTATGTCGCTTGCATCGTCTGAAGATATAGAGGCGTCGTCGCTGTCAGCTTCGGAGCAGGAATCGCCGTCC
CAACGCATCTTCCGCGCTGCTTGATGCTACCAACTTCGACACTTTAGGAAATAAATAGTGCTTAACTAAAAAAAATGGTGTGGAACTAATTTCTTTTTGC
AGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCA
GGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTGTTTA
ACTATCTAGCATAGTTAAACCTAATCAAATGCATAACGTGTGGCTTTCGGCCAACGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTT
TGTTAACTTTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACACTCTCCCCACTAAGATGAGAACATTCCGTTCTCGAAACTCT
CCTCAGCGAGGTCACGTCTTGTTAAGACGGCGGAGGTTACTACACCTCACACCAGCGTTGTACAGCTCCGTGAGCTCACAAACGCCTACGCATCGCTGAT
GCCCAACTTCTCGTCGTCGGCCCACGGCCCAATGCTCCAAGCGCAGCGCGCATCTTGCTCTCAAGCGGTCTCAGACCTACGCTCGCGCTCCGCGCCTACT
CCAAGAGCTGCAAACCGCTTAGAGCAATGCTCTTGACTCATTCGAGTCGTCGACAACAGCTCAGCAGTTGAACACTCGCATCTCAAGCGATAGGTCGGTG
GTTCAAACCCACTAGGGCACAGCCCTCTCGTTCCATGAACGATTGTTCACGCTTGGACAAGGTTAAGGGCAACACCCTTTTAGCTCAATGGTTGAGCGTT
GGCTTTGAGAGCCACAGGTCGGTGGTTCGAGCCCACCAGGGCACAGCCCTGTCGTTTCATGAACGATTGTTCACGCTTGGACAAGCTTAAGAGCTAATCC
GCTTTTAGCTCAGTGGTCGAGCGTTGGCTTTGGAAGCCACAGGTCGGTGGTTCGAACCCACCAGGGCACAGCCCTCTCGTTCCATGAACTGTTGTCCTTG
AATGGACAAGCTTAAGGGCAACGCCCTTTCAGCTCAGTGGTCGAGCGCTGGCTTTGAAAGCCACAGGTCGGTGGTTCAAATCCACCCGGGCGCAGCCCTC
TCATACCATGAGTAGTCCGTTCTCGGACTGACGTACGGGCATCGCCCTTATAGCTCAATGGTAGAGCTCCGGCCTGTCAAGCCAAAGGCCAGTGGTTCGA
TCCCCGTCCGGGACACCACTTTCGCTGTTACAGCGCATCCACATTTGGATCATGCTCATCGAGCAAGTTGTTTCAAAACAACTATGCGTCTATCGAGACG
CTTGTGCCTGAACCTTGTTCAGCACAACACGAAGCACCTGCTTCCTTCGGGACCATGTCCCTAACACTACGAGGTCTCCCCACCTCCTGCTCCCGCTGCG
AGCACCGTTCATACGTACGAGCTGGCTGCTGCAGCCACTGGTCAGAGCCTGAGCTCAACTACTGACCTCATCGCTCCCCACTCTAGTGGGAGGCGCTCAG
CGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACATGATGTGTTCGGTCGTAAGCGTCAACGACGTCAGGGCAATCTTGCTGAGATAACCTC
AACTCCCATGAGTTCTGTGAGTGAGGGTAACTCTTCCACTTCACTAAGTACTGGGTACGACCTGCGGTCTACGCCACGCCACAAGACGTTCCACGTGAAA
ATGAGCTCACCATGCTCATCGAGCAGAGCACGAGGAGGCCTTGCCTCAGCTGGGCTCTCGCGG