Description :
From Genome Similarity Track
Location :
scaffold_483:21911- 25645
Transcript NameFunction/comments
g8719.t1hypothetical protein
g8720.t1 hypothetical protein PHYSODRAFT_262200

Sequence
3734 bases(100 bases per row)
CTTCGTACGCCCTCATCATTTCCGGAACGTCCTCCATTATGGCGATCCGTGGTTCCTATGAATCTCGATGGGGACGAAATCCTCTCCAACGAATTCGAGA
ACGACGACTTTGATGGGTCGTCGTCGTATGATCCACGATCAGCTCACCTATCCAGCGAATCGCTCCTTTCGCGTCGCACAACGGCGGCGGAGGTGGTGGA
AACACTCCCTGCGTATGGTCAACACCATGACCATCACGATCGAGTTGCTGCTCTTGAGCGATCCCAGAGCGCTGAGATCGCATCTCTGTGTCAAGAAGTG
AGGAACCTTCGTGCTGACGCCGGTCAGGCGGCTCATACGGCCCAACCCTCTCGTCCAGCCTCGGCTCGTGGCTGAACTTGTATGTCGAGCGCCTCCGCGA
GCTCGAGGAGGCCTTCCAGGCCTCCCAGGCAAGTCATCAACCCTAGATGACTCGTGGTGCATGTACGGCTTCAACCGCTCGACGTAAAACGTCGGATGGA
GCCTCATGCTGGAGGGTATGTCCAGCCGATACGCGTTGGCGTGCCGTTCAAGTACTGTGAACGGCCCAATGAATCTTGGAGCAAGCTTACTTGCTCCAAA
GTCAGACACTGCATGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATGAACCCTTTTTGAATTCATTCATATTGCCCCTGCCAACATTATCAGTGTTC
AGCTTCTGTCGATCGACAGAAGCTGCGATAGCGTCTTGCACAAACCGTATCACGGCTTGTCTTCGCTAGACTTTGTCCAGCGAAGAAAGGATTCAGCTCG
TCGTCTTCGTCCGCAGCAGGCCCTGCCTGCGCGCTATCACTCCCTATGTCTGTGCCCGGCACAGACATCGCGCGTCCATTCCTACTCGAACGAGACGCTT
CACGCATCACCGCAGCTGATAGTGTGCTATCAGCTGTATTCTGCGGTTGTTCAGACGCAACCGTAGATCCTCCCCCACTTAAGGAAGAAGCTATCCTGCC
GAGAATGCTCCGCAAACGTGGATGCCTCATGGCGTTCATGTGTAACGGTGTATGCCCAGTCGAGGCATGCACCGATTTGTTGATGGCAAACTCTGCCATC
GGCAAGCACTCGCTCCAATGCGAGAACGAGTGAGCGTAGCTCTTCAGCGCGTTACCCAGTACACGGTTGACGCGTTCGGTCTGTCCGTCCGTCTGCTGAT
GATCCGCAGTCGACATTGACAACTGTGAACCAAGAAGTGTAAACACTTCTTGCCAGAACCGCGCTGTGAAGCATGGATCACTGTCCGACACAATGACGAG
CGGCATGCCATGGTGTTTGAACACCATGTCAACAAACAGTCGCACAGTCTGCGCGGCTGTAACAGTAGTCGGGACGGCAGCAAGATGGGCCATCTTGCTG
AATCGGCCCACAAAGACAACGATGCCCGTCCTCCGCTTACTGTCAGGCGGAAGACCGAAGACAAAGTCCAAGGACATGGTCTGCCAACACTCCGACGGAA
TCGGAAGTGACTGAAGAGGAGCCTACGAGAACGGGCAGGCTTCACGCGTTGACAAACCTCGCAAGCACGAACGTACTTGCGCACCCACTTGTGCTGGTGG
TGCCAGTAGACGTCACGCGTGAGAAGAGTGTATGTCTTATCACGACCCGGATGCCCTGCCGTAGGGGCAACGTGATACTCGAACATGATCCTCAATCGCA
GACCATGATCATTCGGAACGACAATGCGGTCCGCATCGTCGTCAACTGCACTGTACAGCAGTAGCCCTTCGTGTGCACGATATCGGTGTACACGAGCCCG
AAGATGAGGGGTTAGCTTCCGACGCGCCACGTCGGAAGGTGTTGGAGGTACTCCAGCAACCCCTTCGCGTCTGCATCCCTTGCGTACGCGCTCTTCACGT
CGTCAAGTAACGTTGACGACGGAACACTTGTCCTCACGACGCCAACCGCGTTGGCGTCGACCGTCTCCGCATAGTCAGGTCGACGCGATAACGCGTCGGC
CACTACGTTGAGGCTTCCAGGTTTGTACTCGACCCGGAAGTCGTAGTCCGCGAAGAAGGACAACCATCTCGCCATACGTTGCGAGATGTGCGCCGACTTA
ATCGCCGTCCGCAGTGATGCGTGGTCTGTATAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGGAACTTTGCGAGTGCATACGTCATGGCAAGGA
GCTCCTTGCCATGTACGGGATAGTTACGCTCAGCTCGCTTCAGCTGACACGATTGATAGTAGACCACACGTTCACGCCCCTCGTGATCATGCTGCATCAA
TGCGCATCCGATTGCAAAGTCGGATGCGTCACACACCACGTGGAATGGACGATCTTGGTCAGCCACTGCCAAGATCGGCACCTCAGTGATGCCCTGCTTG
ACTGTATCGAACGCCCCATGGCACTCGGTCGTCCAAATCCACTCAGCTTCTTTCTTAAGAAGCTGCGACAGCAGCCGAATCTTGCCCGCGTAGTTCTCCA
CGTACTTGCACAAGTACGACACGAGCCCAAGGAACTGCCTCAGTTCCTTCACATTGGATGGCGTGGGCCACTCATTGATCACTCCGACCTTCTTTGGGTC
AGGGCGCACGCCGTCCTTCCCGACGAGACACCCCAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTTAGGTTCGCGTAGAGCTTATGCTTCCTC
ATAAGCTCTAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACGTCCGTCTTACCGTTCAGAGCCCGGCTGTGGACGAACACGTCGTCGAAGTAGCTCG
GTGCGAAGTCGCGCACCGAGCGCAATAGATGTGTCACGCATCTATTGAACGTCGCAGGGGTATTCTTAAGTTCCTGCGGCATGACGAGCCACTCCCAAAG
CATTCCGCTTGGAGTGCTTGCCGCTGTGAGAGGTATATCCATCTCACGCATGAGGATTTGATAGAATCCATCACGTAGATCTAGAGCACTGAAGATAGTG
CTCAAGGCCATCGAATCGATGATCACATCTTTTCGCGGTATCGGCGTCTGCGCCGGTATCATCGCATCGTTCAACTTGTTGTACGCATGAACGATGCGCC
AGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGGGCACTGCGCGGGGACTTTGATTCCCGCACTTGACCTGCAAGACGACGACTCTCAAAGAAATCGTC
GATCGCTTGCACCTGTTCGCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGTACGCCCTTATCTTTC
GGAAGCTCCGAAGGAATCTCGTCAGGGAGTACATCCTTGTACTCCCGCAGAATGTCGTAGTAGGGACTCGACCTCAACGAGTCTCAACTCTGCTCCTCAA
AGTGCTGCTTCTTGGTTTCCGCACTGAGGGGGTCATCGCCCTCAGTGATCCCATCGACGATGAGCTGCTTCAGCTCTTCGGCCTCGCGTTCACTCTCTCA
ACATCTGAGAGGATGCAAATTTGTTCGATGCGTCCATCGTACAAGCCCCGCGCGAAGCGCTTCCAGCTCATGACTGGAAGTGCGATCAACGCCGACGCAC
ACGTCGACGGATTCTCTAACCGCATCTTCTGGTACTGCAATCCAGTACCAGTACGTGTCAAGACGTTCAACGTCTCGACACTCGGTGTCTGTCCGGCAGA
TACACCCGTCTCAGTCCCGGACTGAGACTCCCGC