Description :
From Genome Similarity Track
Location :
contig_35:219091- 222024
Transcript NameFunction/comments
g7976.t1RAW26717.1 hypothetical protein PC110_g16886 [Phytophthora cactorum

Sequence
2933 bases(100 bases per row)
ACTCTAACCAGTTAGATGACCAAGTCGAGCGAGCAGCGGAAGGACAACGTGGAGATGCATATGTAAGTTAGTACAGCGGATTTTCATCTTAACCCATTAT
TCCCCGAAGAGCGTCCTATTGGTACGTAGCCTACAGAGTCCGAGAGGGCTAATGCCTGAGCCGGCTATCACCCTGCAACCCTCTCCACCTCCAGATAGGC
ACATGGTGACACTAGGAAACGTTTCTGCTTACGTCTTGTATAGAAGCAAACTTGGACGGTGCTCAGCCTCGTCATGCAGGTCGCGTGACGTGACATCCGT
TGAGTAGCTCTCGAGCCGACGCAGCATTCTCCTCGAGCCTTACATCCGCGCTGGGAGGTCCGCCAAGCATAGCATTTTTGGATGTGGCGGGTAGCTCCTC
AGCCGGGACTCCTTCAGCGTTCCTCTTCCTCCGCATCCTCCTCCTCGCCTCCGCAGAGGACGGCGCTTGCGCGGCGCTAGAGCTTGGAGACTGGACGAGT
GTGCTTGACGGAGCGAAGTGAAGAGTGAGAGCTTGCTGGAGCAGTGAAGCGCTGCCAGCGAAGCTGGGTTCAGTGTTGAAGTGCGTACAGGCAGCAATGC
GAGGGAGGCAAATTACGTGGATGGTGTACAATATGGCAGTGCAGAGCTTTAGGTTAGCCTTGAGAGAACTGTACGGACAGACCTTCCCAAGTCTGGACTG
GTTAGTGCTTTATACGTTCCTACACGTTGTGAAACAGAGGAAAGTTCATCACATGAGCGTTGAAGTCCTTCATGACGTAGCACAGGTCGGGTAAATGTAG
TCCACACCATAGACCTCTCATTCAGCTTCCCGCGCTTTTTCGCCTCCCAATTGGTTCAAATTCAAAACGCCATCGATCATGTCGGCGTCGTACGCGCTGG
AGCTGCACGCGCTGAAGGCGGAGCTCCAGAGCACACTGGCGCGTCTAGGTATCGACACAGTCAGCTCTGATGATGAAACAGACGCTCGGCATCACGTAGA
CGCCCTGTCGGTACTGGAAATCGCCGCAGAATCGACCGAAACGCGACCAAGGCGGCGGAATTCTGGCCGCAATCGGCCCATCACGCGCTGGAACCGCCGT
CGATTGGTGCACGAGTTGGCTGCGGCATCCAGTAGGAGGCGGCAGCTGGAGACACAATTGCATCGCGAGATGGAGAGCGACAGGCAGCAGCAACAGGTCA
GCGACGAACAGAGCAGACGCCAAAGCGCGTGGCAGGCGGCGATCCTCGAGTTGCAGCAGCAACGCGCCGAGATTCAGAGGCAAATGGAGGCAGAGACAGC
AGAGGAGATGCATCAGACAGCGGAGAGGGAGCGGGAAGAGCAGGTTTCTGGTGCTGAGGACCAGAGTGAGAGAGTGACTGACAGACGACCGACGGTGGAG
TCTGTATCAGAGACCCACTACTCGATTGGCGGTGTGGTGACGTTGGAGCCTTTGGCTTCATTTCAGCAGGTGCCAGGGCTGGCAAGCTCGAGAAGTGGGG
TTTCGATGCGACCGACCGTTGTTACTGCGGCAGCTGTGTCGCCAACGGAAGCTTCAGTATCAGCACCAGCGATGGTGTCGGTGTTGGATGCTTATCCTCG
CTACAGGAACACGCCGGACGCATTGAGTGACGTGTTTTCGCTGCAGCTGAAGTTTGCGGAGACGATGCTCAAGCTTGAGAAGTCGGTGCAGATGCGTGAT
CGGCTGCTGCATCATGGTGGAGCCTTGCCCAAGCATCGTACAGCTGCATACAATACTCGACAAGAGAGCCATGCACGTCGTCGTCATGGTCACCAGTCTG
TACATCGCAGAGCATCATTTGAAGGCAATTCCAACAGCGACTCTAGCGTCATGTATAGAGAAACGCATCGTAGTGAATCGTACAGCTCCAGCGTGTATTC
GCCTTCGTCACTGGATTCAACGCCGCGACGTGGCGAGACCATTCGAGTGAGGTACCCGAACTTCGGAGTATCAAGAGCAACCACGGCTGAAACACTTGCA
CCTTCCTCGTCGTGCGCAATTCATTCGCCTAGCTTGGACACGACAGGTGGAGGTGCGCCTGCATCCTCCACGACAACTTTATCACCTCAAGAATCGCCAA
GCGCACAAGATGCTGCTGCGCAAGGGAGCGACGCGCAAGGCGAGCTTTCCGAAGCCCGGGACGAAGAGATTCACAGGACACCCACCACCGGTAGTAGTGT
GACTACCCCGACGACTGGGAGTGATCAGAAGTCCAATGCGTCATCGAAACAGGTTCGCTTTGGAGATGATGCGTATTCGACTCCAGTGCTTGCCCGTAAG
TTCAATTTCGACAACCCGTCGATCGATGAAGATGATTTCGAGGAGAAGACGGAAGACGAGGAGAGCATCCCGAGCTTCCTCGGTGGATCTACCGTTACCA
GTGTCGAGCTCAATGACGCTTCATTTCTTCGAGCTTTCCAGCGCTTCCGTCGCGAGTTGAAGGTATCAGAGCACGACTCTTGCCTGCAATCACCGGTGCT
AGCGAGGAAGCTTTTCCCAGCATCAAATATGGACTTTCCTTCCTTAAATTCTGATGATGAAGGCGCGAAAATTGATTTATCGATCTCTGATGGAGCGACA
GGCGACAACTTTGCTCAATCTGCCAGCGCTCCTGTTGAGGAGCACGATCAAACAGCAAGGTTTCCTGGTCTCAGCGGTTTGAGTGTAGAAGAGTTACAGG
AGCGTCGGAGGCAACTCTGCCTTGACATCCAGGCGGCAAGTGCCCAACTTGTGCTAAACTTTGGGGCGATGCAAAGCGTAGCTACTGGGTCTCAAGGTGC
AGACCTCACGAAGGACTGTTTGCTTGCATTACGAGATGAGCTCAAGGCCGTCGACTCACAGATTAGGGAATTGCAATAGACGGTACGCTTGTCAAAGTCT
CTCTCTCATTCCAGAATCTGCCGTAATGGTGGC