Description :
From Genome Similarity Track
Location :
Scaffold_604:2190- 3738
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.6Sodium/hydrogen exchanger

Sequence
1548 bases(100 bases per row)
NNNNNNNNNGTTCTGGCTCCGAGTCCATTGCTGCTGGGTGATGGTACTTGTGCTGCGTGGGGGCGGTCGCCGTGGTAGGTGATAGTGTAGGCANNNNNNN
NNNNNNNNNNNNGTTCAATGGCGTGCGCTTCGTCCGCCCCCTCGTCTCAGGCATGATTGGATTTTTCGCAGCTATTAAACCCAACTGTCGGATCTCTGTG
TCGTGACTCGTGTCATGAGGCAGCGCAGCTCTCAACGCGCGGCAAAGCACAAATTCCAACCACTCCATCCGCCATGGACGACTTGAAGCGGCAGGAATGG
ACGGGTGGTGAGCTGCTCGTGTGCGCGCTGCTGGAGCTGCTTATCGTACGCATCGCGTATCAAATCGACCGAAGCAAGACGGCGCCGTACCTGTCGACTG
CTGCCTGGGCGATCGTACTCGGCATTGGGGTTCGNNNNNNNNNNTTTTGGCTTTGCTTGCCTTTAATGATTGAAAAACTTATGTTTGCGACTCGCTCATG
TCTGTAGTTTGGCTTGATGCTGTCGCTGATATCAAAGGACGTACGTTTCTCTTCGTCATGTGCAAGTATCTCTTGTCACTATGCTGACCAATATGATTCC
ATGTATCGTATATTTTGAAAAAGCGCGCGACAGACATCGGTTTGGATCCCCAGATCCTGTTCTTTGGACTTTTGCCGCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTAGAAGGCGGCTTCAGTACACAGCACCGCGGCTTTTTCGCCAACTTCTGGGACGTTTTCCTGCTCGGTGTCGTTGGTACGGTTGGTGCG
TCCGTCGTCACTGGCGCGCTGCTATACTGGCTCGGGCGCACATCGCTGCTCGCGATCGCGTTCACGCCCTCAGAAGCCATGCTCTACGGCGCGCTAATCT
CGGGAATTGACCCGATTGCGACTCAGCTCGTGCTTCGGAAAAGCCATGTGCCAACACTAATTCCGGAACTCGTCTTTGGCGAGCGCTCGCTCAACAATGC
CATCAGTAAGTTTGCATTGCTGTACAACTCTCGTCGAATGGTGAGGCTAATTTACGTTGGTGGATATGGCTGGTAAATAGCGGTTGCGTTGTTCAATCTG
TGTGAAATGCGCGTGCAAAGCGGCAATTCTGAGGTGACATTTGCAAATGCGATGAATCTGTTTCTCGAACTGGTCGGTGTCGGTGTCGGGTCGCTCGTGC
TTGCTNNNNNNNNNNNNNNNNNNNNNNNNAATCGTCGGGTATTCGTCAGCGTATCTTCTCCGCGTAAGTCCATACTTGCATGATTACATAATTGGAATAT
ATATTGGTATAATGACAGGTTGTTGTTGCTTTCGGCCATCCATAGCGCTCGGACGAATTGCTCCGACAGCACCAAGCGTACGAGATCTCAATTTTGCTGC
TCTTTGCATACGCGAGTTACTTGGCGGGCGAGTTTTTCCACTTGAGCGGCCATTTGGCCGTGTTTTTCAGTGGCGCGTTCATTCGCCACTACCACGTGTA
CAGCATTTCCCACGCGAGTGCGACGTCGTTCCGCCACTTACTGACCAC