Description :
From Genome Similarity Track
Location :
Scaffold_350:219- 7461
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.17Ubiquitin carboxyl-terminal hydrolase and/or F-box protein
Pytve_DAOMBR484maker-pve_contig_350-fgenesh-gene-0.0Kinesin

Sequence
7242 bases(100 bases per row)
CCTCGCCCGAGTCGCCCGCGTTCCACCACCGTAGCCTGCACCACCACACGCCCATCACAAGCGGAGCGAGCTACCACCTGGACTCGGCGGGCCGCACGGG
GCCGACGACGTCCTCGTCCNNNNNNNNNNACATTGTGCGCGTCGAGATCCCCAAGTGGAAGTCGCGGCTGCCGGACCACCGCGGGGCCGTCCGCGGGGCC
TCAGCCCTCGCGGCGGCGCTGGCGTCCCCCGGTCCGCCGCAACGAGGATCGTCGTTCGGCAGCAAGAAGAGCAAGAAGAACTCGACCGCGGCCTCCTCTA
ATAAACACAAGAACCACGCGGCCAAGCCCGAGACACCCGGCCACAGCGGCTCGCTNNNNNNNNNNNNNNNNTCTCGGCCTTCGACGGCATGAGCGGGCTC
AGCGGCCGCGGCGGCGGCGGCAAGCGCTTCACGGCCTTCCAGGTCTACGTGCACTACCAGTCCGGGGCCGTGCGGCTCAGCGAGAAGCGCTACTCGCACT
TCCGAGAGCTCCACAAGACGCTGCGCGCCAAGTACGCGACCGTCGGCAAGCTCTACTTCCCGCCCAAGAAGTTCTTCATGTCCAACTCGCTCCACGTCAT
CGAGCAGCGCCGCGAGGGCATTGAGGCGTACATGAACGCCGTGCTCTCGCTGCGGCCGCGGCCGCTCGAGGTCGTGCACTTCCTGGCCGGCGGCCGCAGC
CTCGAGGACGAGAACGAGGACGGCGACGTCCCGGACGACCTCGTGGCCGACGTCGACGTGGCATTGGGGGCCACGGGCGCGAACGACCACGGACGGCTGT
CGTCGTCCAGCGCGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGAGTCGTCGCTGTCGATCGCCGAGCCGCGCACGCCCCGCGCGGTGC
AGATGCAGGACTTTGAAGTGCTCAAGATGCTCGGCAAGGGCTCGTTCGGCAAGGTGTACATGGTGCGCGAGCGCGGCGGCAGCCACGACATCCTGGCCAT
GAAGGTGCTGCGCAAGTCGGAGCTCGTGAAGCGCAACCAAGTGCACCACACGCTCATGGAGCGGCGCATCATGAGCGGCACGGACCACCCGTTCGTGGTC
GGGCTGCGGTGCGCGTTCCAGACGCCGAGCAAGCTCGTCATGGTCTCGGACTACTGCTGCGGCGGCGAGATCTTCTTCCACCTCAAGAAGTTCCGCTCGT
TCTCGGAGGCCATGGTGCGCTTCTACTCGGCTGAGCTCGTGGCCGCGCTCGCGCACCTGCATGACAAGGACATTGTGTATCGCGACCTCAAGCCGGAGAA
CATTTTGCTGGACGACCAGGGCCACGTGCGCATCACGGACTTTGGGCTGTCCAAGACTGAGTGCTCGGACTTTTCCGGCGCGCGCACGTTCTGCGGCACG
CCCGAGTACCTCGCGCCGGAGATGCTCATCAGCCGCAAAAAGAAGACCGAGTACGGCAAGGCGGTGGACTGGTGGAGCCTCGGCACGCTCATGTACGAGA
TGCTCACGGGCTGGCCACCCTTCTTCGACCGCAACATCGAGCAAATGTGCACCAAGATCATGAAGGCGCCGCTCAAGTTCCCGTCGCACTTTGGGCTCAG
TCAGGACGTCAAGAGCCTCATCTCGGGACTACTCGACCGCGACCCGACGTACCGGCTCGGCTGTCGTCCCGGCGCCGGCGTGCAGGACATCAAGGGCCAC
CCGTTCTTCGCCGACATTGACTGGGAGCTGCTCGAGCGGCGCGGAGTCAAGCCGCCGTTCAAGCCGCGCGTGCGCAGCCCGACCGACATCCAGAACTTCG
ACCGCGAGTTCACGCGCGAGGCGCCGGACCACGCCTTCCTCCAGGTACGTGCGCTCTGGCTGTGGCGGGTGACAAGGCGCATCGTGGTGGTGGTGCTAAC
AGCTCGGTCGCACTACGCGTCGGTCGTGAGCAGCAGGACCGCCGGCTCGTCGTGTCGCCCAAGAACGAGTTCCGTGGGTTCTCGTACACGCGGGGCGTGT
CGTCGCCGGAGCCGCGCTCGTCGTTCAGCNNNNNNNNNNNNNNNNNNNGGCAGTCGTCGAGCCGCCGCGCGAGTCGCTCTCGGTTCTCGGACGCGCGCGA
CGGGTACGGCATCTCCTCTTCCTCCTCTTCCTCTCGCTTGCCGCCCCGGTCTGCTGCCTCCGCGTCGTAACGCTCTTGTCTCTCGTCGGTATCCCCCAGC
GCGCGGCCGACGCTCGCGACCGCCTCGCAGTGGTCGAGCCTTCGGTTCGAAGACGACGGCGACCACAACGGCCGCCTGTCGATGGACGGACGCGAGGTCG
AGAGCGGGTGCATCTAGCGAGCCAGCGAGTCAAGGCGGAGCGCCACGTACGAGGCCAGAGCAGCAAGACGGACTCTCCGCTCGCCTTTCATTATCCCCGC
GCCGCCCCGGCGCATCGACGCGGCCGTGGCGGCGCTGTGTGCCTTTGTTTCCATGTCTAGAGATCAAACCGAATAAATATACAAAGTGGCGGCGGGAGAA
CGAACCTCCTACCCGCTGCAAGATTCCACGCGAGCCCTGGCTTCTCTCCTTCTCTCTCTATGCGGCTGTTGTCGTCACCGCCACGCGCCGAGGGTGTTCG
TCTCGGCCGCTGGCCGCTGGAAGAACACGGGGAGCATCTCGCGCATCGCGTGGCTCGGCTTGTGGTCCTGGAAGTCGTACACGCGCTGCCACTTGCCGTC
GACGTTGGCGTACCGGTGCGTCACCTCCTGGCAGTGCACTGCATCGTCCATCGAGGCACAAGTTAGCCGCCGTCGACCGCCATCGCCATCGCCGCAACAG
CAGGCATCAGCAGACCGCGAGGACTCACCATGGCACGCCGCGCACAGGTCGTAGTCGCTGCACTCGGCGCAGTTGAACCGCGCGCCGCGGAAGTCCGTCT
CGCCGCACGAATCGCAGATGAAGCCGAGGTGCCGCCCGTCCATGATGTACCGCAGCGTCGCGCGCGCGTCCTCGCGGCACTTGCGGAACGCGCTGCGAAC
GCGGAACTTGGGGATGTCGAGCTTCTCGGCGAGCTCCTCCACGTCCGCGAGCGTCGGCGGCGGGTGGAACNNNNNNNNNNACTCGGTCACGAGCCGCTGC
GCGACCGCGTAGTGCGACAGCAGCAACGCGCGGACGGCCTCGGCGCTCTCGTCGACCAGGCCTCGAGCCGCGAACACGACGATGTCGGCGGCCGCNNNNN
NNNNNNNNNNNNNGTCGACGCTTGACGGGAGGACAAGGCGGCAGCCATCGGCTCGTAGCTGAACGGCACGGGGGCGGACAGCACGAGCGGCGCGATCTCC
TCCTTGAACATGACGAGGTCGGCCGGCGTGCACGAGCAGCGGGCCGCGGCGGCGTCGTAGAGCATCGCGGACGAGAGCGCCTTGGCCGACGAGAAGAACA
CGCGGCCGAGGAACTCGAGCTGTCTCGTGCGCGGGTCCAGCACCTTGACGAACACGTAGCCGCTCGAGTCTTCCTCGGCCGCCACAGCGGTCTCCGTCGA
TGATCGAACGCTCTCCTTGCTCGTCGTCGGTGCAGGAAGAGCTGCAAGATGGTCACTGACCGCTGAAGCCGGAACGTTCATGGGTGGGTCGTCGGCGCGC
GTGTCCTCGACGTAGACCTGGCAGAACGAGTACGCGTCAATGTCGACGCCGTCGCAGAGCAGGTGGCCGAACATGGGCTGTCTGCGGTCCACGTGTGGAG
CCGTGAGCAGCTTGCGCGGCCGCAGCGCCTGGCCGGAGACCACGGGCTGGTTGAAGCACCACACGCGCGCGTGCTCCGGCGCGACGTCGTAGAGCTCGTG
CAGCCGCAGCAGCAGGTCGTGCAGCGAGCAGCAGAACGGGAGCACGACGGCGTCGACCCTGGCCAGGTCCACGAGCCCGAGGTCGTGGTGCGCCTTGAGG
TCGCTCTCGAGCACGACGCGGAACGTGATGGACATGAGCCGCACGCTGGCGGACACCGTAAGCGTGTCGTGGGGGCCGAGGAAGCCTCGGCGCGGGTCCT
TGAGCGTCTCAAGCGCGCCTAGCGCGTGCACGCCCCAGTTGTTGAGGCTGCGGTCGAACTTGTTGTCGACGAGGCACGAGTGCCACTCGATGGCGTCCGC
GGGGGCCGCGTGGTTGCGCACCGCGAGGGAGAAGACGGCGCACGTGAGCCAGTCGGGCGGCCGCTGCTCCAGGTCGGTCAATACCAAATAGACGCTGAGC
ACGGCGCCGGCATACTGCGGTTCGTTCGGGTTCCCATTGGGAAAGATCCAGAGGCAGAACCGGTGGCTGCCGATCGCGAACGTGTCCGACACGATCTTCT
CCACGCCCCCCATGTCCTCGCGCGCGAACTGCGGGATCGCCACGGCCACCTCGGCACGCTGGTCACGCGAGTGCTGCTCCGTGAAGCATCTTCGCCAGGA
CCCGCCGTACAACCGGATCACGTCGTAGTCCGGGGCCCCGGGGAGCTGCGGCAGCGTCTGCGCCGCCAGCGACGGCCACCGCGCGAGGCACAGCCGCCGC
CACACGTCGCGGTCGTACGTGAGCGCCCGCAGGGACCGACACGCCGCCGCACACCGCAGCAGCGACCGCCCATCAAGATGACTTAATGATAGAGCCAATA
GCTCGGCGGGGAGAGCGCGGACGAGGGACCGCGGCCGGGACGAGTCGTCCTCCATGTCGACGTCCCTGGCGGCCTGGAGCTGCTTGTGCTGGTCCTCGTC
CGCGTCCAGCGCCGAGGGCGAGAACTGGTCCATCGGGCCGTCGTCGTCGCACTCCATGCTCTCCGTGTCCGTGTCGCCGGCGTCGAGCCGCAGGAAGCTC
GCGCGGAACTTGGCGAGCAGCGACGGCCGCGCGAACGGGCCGACGACGCTGTTAGTAGTTGATCTACGGGCGGGGGACGGCGCCAGCACCGCCGGGCGTC
GCCACTCGCGGCGCCTTCGCGGTGTACTCGCGGTCTCGGCGTTGGTCATGGCGACGACGTCTCGAGGGCGGAAGAGCGCGAATGAGGGCGGGGGAGCGCG
GAGGACGCGGGTGCGGGTGCGGATGCGGTGGTGGCCCTTGGCGCGCGGGGAGACGCGGGAGGCGCACACGGAGCGACGCGCGGAGCGGCGAGCGGCGCCG
GTCGCCTCGAGGAAGGAAAATGGGCGGAAGGGGCGGCGGGACGTCGCGCTCCATGCCCGCGGATCGCTCGGGCCGGAGCGTTGCCCGCGAGAAACGCCGC
CGCCGGTTGAAGGAAACCAGCACCAGTCGCCCCCCCTAATACTGCGCGCTGTTAGTGGAGCGAATGTGGCAGGGTATTGACTGTAACTGGTGTAAATTGG
AGACTTGGCCGTTGAAACTGCTCAAGTTCAGTGGAGGGGTATGTATATGCGTGGGTTATGGGTTCATGTTTTTGCGCGTAAACAGGCTCGAAAAAAACAC
CTTTTCTGCCAAAAGATCGCTCTTTTCGAAAGGGTAGTTCCCCTCGCAAAAAGCGCAAAAAAATTAGAAAAGCGCGGACAAGGCAGGCGGACCGGTGCAG
AGACCGGACAGCGGAACAGCCGGAACGTGCATGGAACACCGCACGCACACCGCCGCCGCGAGATCTATACGGCCGGATCTTGCAAATGTAGGTATCTACC
TACCTCTCCAAGCGCATCATCCCCATCGATCATCAAGGGTTTTGAAGTTTCACTTTTGGTGTTTGGCGTGTGGCAGGCGAGGCGGACCGACCGACGGACC
GACCGACGGACCGACATGGCGTGGCGAGCCAACCCGCGTGCGAATGGCGCGCCTTCCGAGGCTGCTGCACGGCCAGTGAGCGCCGCGGCAGCAGGGGCAG
CGGCCGGCGCGCGGGCCAAGCCGACGATCCAAGCGATCGCGCAGGTCCGACATCGATCCGATGCCTGGCGGCGCCGCAATCGCTGCGACGAGCCAACCCA
TTCACCACTGTCTATTATCCATGCAGATTGAGCGGAACCGCGAGAACCGGCGTCGCGCCATGGCTGCGGCCAAGAAGGAGCGCGAGCGAGAGAACCAACG
CAACGAGCGGCGCGGCGAGCCGGGGGACGTGGACTTCCAGCGCATGATCCGCGTGTTCCGCGAGCAGAACCGCGAGAAGGCCGCGCCGCACGTGGAGCCC
GGCGAGACCAAGATCACCATCTGCGTGCGCAAGCGGCCGGTGAACGCGCGCGAGGTCAAGAAGCGCGACTACGACGCCGTCACGTGCCTCAACCCGATGG
CCATCGTGCACGACTGCAAACTCAAGGTCGACGGCATCACCAAGTACCTCGACAGCAACCCGTTCAACTTTGACCATGTGCGATGCGGACACGTAGTGCT
GTATGGGCGACTCCAGAGCGAACTAATCCGCGGTGTGGCGTACTGCGATCTGTAGACGTTCGACGAGAGTGTCGAGAGCGAGACGGTGTACTTGTACACT
GCGCAGCCGCTCGTTCGGTTCATCTTCCAGGACGGCGGCCATGCCACCGTATTCGCGTACGTGCATAACATCAATGTTTGGTATCGAGTGTCGATGATTG
AGCACTTTGGCATTGTTGGCGTGCAGGTACGGACAGACTGGCAGTGGCAAGACGTTCACGATGCAGGGCATCCAAAAGCAGATCGCGGCTGACGTGTTCG
CCAAGGTTCACGAGTTCGAGCAACTGTACGCTGTGTCTCATTTGATCTGATTGACTCAATCTCCACAGCTTCCTCTAATGAACGTGATCCGTTCTTGCTA
TGTGACAGTGGCACGCCGTTCAACGTTTGCGTGAGCTTCTTCGAGATCTACGGGGGTCGGTGCCAAGATCTGCTGCATCGCCAAAAGCTGACGATCCGAG
AAGACGGGAGCGGCGAAGTGCAGATCGTCGACTTGCAGGAAGTGCAACCCACGACGACGGAGGAGCTACTCCATGTCATCCACAAAGGGAACAGCTTGCG
CACGACCCATGCGACCGAAGTGAACGACATGTCGTCGCGCTCGCACTGCATCTGTCAGATTGCGATCCGCGAGCGGGCGAGCGGGAAGCTGCACGGGAAG
CTGTCGCTCATCGACCTCGCGGGAAGCGAGCGAGGACAAGACACCAAAAACCATAACCGGCAGCGGCGGCTGGAGTCGGCGGAGATCAACCGTAGCCTTC
TGGCGTTAAAGGAGTGCTTTCGGTGAGTCGATTGCTGTGTAGTGTCATTGCGTCTCAGAAGTTGCTTTCTCACACTGCATTTCACGTGTTTGGTTCCCCG
AAGAGCGCTCGACAGTGGAGGTCGGAACGTCCACATCCCCTT