Description :
From Genome Similarity Track
Location :
Scaffold_357:219- 4813
Sequence
4594 bases(100 bases per row)
GACGGGTACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACTGGATGC
GAGGTATGACTCATCCTTGGCATGGCATGGCTGGAACGTCATGAGCATGGATCGACTGGAAGTCGAAACGCCCGGGTGCGTCGCACCCTGCTCCTAGTGG
AGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTC
CGAAATTGTTAGCAACGAGGTTGCTGTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTG
GGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTAAGTGGTATGAATCTGGTCGATGACCTACCGCTGCGTGACCAGAGGGTCGCGGTCGACT
GCGAGTCGAGGCATCATGGGCGTGGCCCATGAGATGCAGGTGAAGTGACACCTAGTTCACTATGTGAAGGTCAAGAACCTCTTGACTTTCAGCCGAGTGT
CGTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGG
TCGCGGAGAGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCT
GTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGAA
CGAGATGTCCATTGCCGAGTTCGGCGAAGCCTTAAATGCAGGCGGGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTC
GTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTATCCGGTGGTGA
AGGTGTATAAAGACGTTGTCTCAAAAGACCCACCGACGGGCTTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGATCCAAATACTG
CGTAACAAGTCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCT
CCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAA
CGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCTGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAG
AGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAGCGCACCAGCAATGTTC
AATCGTCTTGTGACGCAGTTGTTTAGGCCCCGCCGGGCGTACGCTCAAACGTACTTTGACGATATATATGTCCATAGTCGTGCCGAGCACGGAAAGTCAG
ACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGA
AATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAGCCAAAAA
GACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACG
CACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCC
GTTTAGCGTCGTCTGTGAAGCCTCCGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGC
CAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACACTGCTGCTGGAGGTATTGACCC
GCGTAAGGTCCTCCCGGTGATGCTGGGCAGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACA
CCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTT
TCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTC
ATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGAAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGA
GTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCACTTGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAG
GATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTATCGAATCCCCTACGAGGTTCATGGTACGCCCGTGGGCGGGCACTTAGGTCGGGAGA
AGACCTATGGCTCGGTGAGCGCGATGTACTGGTGGCCCAAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTC
CGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCTAAGGATAAG
GCGGGAAACACGGGTATAGTGGTCTTTGTAGACCGATTGAGCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGC
TGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGTCCCGCGCTTCACCGCGAAGTTCTGGACGTCTTTCTCCAG
AGTGCTCGGCACTCGTTTAGACATGTCCACAGAGGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGC
GTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGTTCCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGATTACACTCCGTTCT
ATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAG
CCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAG
AAGGAACATGCAGATACCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGAGACCAAGTTTTATTAAACGCTAAAAACCTGCCTACTCATGCAGTGT
CTGCAGTCTTCAAGACGAAGTTAAGACCTCGGTTCATAGGACCGTTTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGAT
GCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGCTGGGCCACGG
ACAGCTGCAGGGCAGCAAGTGGTAGAGCCACGGGAGGCTGAACGACAGCAAGTGGTGGATCCACAGATGGCTGATCAAAAGCATGTGGCAGAGCCACAGG
TCGCGGAGGAAGTGCTCGAGATGCAGGAGCAAGCCAAGCTGAGCGCTCAGCCGAGCGACTGGACGCTCAAGGTCCGAGACCTGGTTGTCAGTCAACAGTG
GTGGCTCTAACATATCCACAAGGTGTATCATCTCTTCGAGATCGACCGATGGGCGGTGAACAGGAACGTTCGCGTCGTGGACGCCGGCGTCGTATGGACG
CAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCGCGAGAGCCCAGCCGAGGCAAGGCCTCCTCCAGCTCTGCTTGATGAGCATGGTGAGCTCCACTTTCA
CGTGGAACGCGTTGTGGCGTGTGGTAGACGCCAGGGTCGTACCCAGTACTTGGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATGGGAG