Description :
From Genome Similarity Track
Location :
Scaffold_121:219- 3898
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_121-fgenesh-gene-0.1Protein pelota
Pytir_DAOMBR486maker-pir_contig_121-snap-gene-0.24Trafficking protein particle complex subunit 2

Sequence
3679 bases(100 bases per row)
GTCTCCCCCGATGCCAAGCAGACAATCGGGTTCATCGGCCTGGGCAACATGGGCCTCCCCATGGCGCACAACTTTGTCAAGAGCGGCTACAACGTGCTCT
GCTTCGATGTGAACGCGGAGAACGTCAGCCGCCTGGTCGACCTCGGCGCGCGCCCTGCAGCGTCGATTGAAGAGATTGCGTCGCAGGTGAGCACCGTCTT
CTCGGTGCTGCCGAACGATGAAGTGCTGACGAGCGTGGTGCTCGGTGATGACAAGGTCCCCGGCTCAGGCTTGCTGGCGAATCTTGCCAGCGGTGCTCTC
CACGTGAGCTGCTCAACGATCCACCCAGAGACGTCCCGCCACTTGGATGGCAAGCACAGCGATAAGGGCGTGTCGTACATCGCGGCACCGATTTTCGCGC
GTCCGGACGGCATGGAGGCGGTGCAGGCGAACTTTGTCATTTCGGGCTCGAACGCAAAAGCCGTCGAGACCGCGACGCAGTGGCTCAAGTGTACCAGCGC
GGGCGTGTACAACTTTAGCAACGAAGACGCTGGCGCCGCGAACGCCGTGAAGCTCTGCGGCAACTTTTTGATCGCGTCTGCGATCGAGTCTATGGCGGAG
GCGCTGTCGCTCGTTGAGTCGAACGGCGTGGACCGCGTGCAGGCCATGCAGTTCTACAGCAACACGTTCCTCAACTCGGTGATCCACAAGGGCTACGGCC
AGCGCATTTCGGAGCGCGACCACCGTCCGGGTGGCTTTGCGCTCGAGCTCGGCTACAAGGACCAGCGACTCGCGCATCAGATGGCGCTGCAGAACAAAGT
GCCGATGCCATTCCTCTCGGTGCTCATCGACCGCTTCCTGAGCGAGCGCGCCAAGGGCCGCAGCGACTTGGACTGGTCGGCGATAGGCCTGGGCGTGTGC
GAATCGCGCGGCGTTGACGTCTCAGACGCGATCAAGCGCGCACGCGACGCTAGCGACGAGAGCGGGAAGTAAGCGGTTGCTGTTGATGAATAGCTGTGTC
TGTCATTAGAGTTGTTCGTGAAATTGAGCAGCGCTTCAACTTGTTCTCCTCCTGTTTTGACCCATTTCAGTACATTTTAACCCAGTTTTGACCCCATCCT
TTGAAGAAAGGAATGTGTTCGGAATGTCGTACCAGTAGCATTTGGATTGAGATTATCAATGTTGCTTGGACGTGCTCTGAAGGTCGTACCAGGATTGTTT
CTTGCTGTGTGAGCCGAAGCGAGACACGCAGTGAGCCAAAAGCGAAGAGCTCACGAGACAGGCACTCAGACAGTCCGGGAGAGCGAAGATGAAGCTGCTG
AAGAAGCAGATCAACGAGAAGGACGGCGTGGGCTCTGTGGTGCTGCGCGCCGAGGAGCCGGAGGACATGTGGCACATCTACAACCTCATCCACGTGCACG
ACTCGGTCAAGACCACCACGATCCGGAAGGTAAAGAATGAGCGAGCACACGATCCATTTTGGCTTTTGAACACGGACCATTGGATGGATAGGCGTAACAA
GTGGCTCTGATAAACATGCGTGCAGGTCGTGAAAGAAGGCGCGACGGGATCTACGAGCAGCCAGCGTGTGCGCCTGACGCTGCAGATTGAGGTGTGTAGA
TTTTTGCACTGTTGTTGATGCTGCTGTGCGGATGAAGGGGTTCATAAGCTGACAGTTGGTGGTGCTTGGCGTTGCTTAACGATTGCAGGTGGAGCACATC
AACTTTGACCCCGCGCTTTGCGTGCTGCGCATTAAGGGCAAGAACACGATGGAGAGCCAACACGTTCGGGTGCGTGCATGATCCATGGCATTGATGGTGT
GTGTGATCATAATCGCTGTATTGACAATAACGATGCGATGGTTTGCTGTTCTGAAATGCACAGTTGGGAGCGTACCACACGTTGGACCTGGAGATGAACC
GCGACTTCACGCTGATCAAGAACTGCTGGGACGTGATGTCACTCGAGCGCATCGACCTCGCATGCGATATTACGAAGAAGGCGGAGCTCGCAGCCGTGGT
CATGCAGACTGGGCTGGCGCACCTGTGTCTGATCAAGGGTCACATGACGGTGATCAAAGCCAAGGTGGAGAACAGCATCCCGAAGAAGCGTACAGGCAGC
ACGGCGCACGCCAAGGGCATCGAGAAGTTCTACGAAAACATCGTGCGGTCCATCAAGCAGCACATCGACTTCAAGCTCGTCAAGTGCGTGCTGATCGCCA
GTCCAGGCTTCGTGAAGGATGACTTCTTCAAGTTCATGATGGAGCAGGCGATCCGCCAGGACGACAAGCTGCTCATGGAGAACAAGAGCAAGTTCATCTT
GTGCCACTCATCCTCGGGCCACAAGCACGCGCTCGACGAAGTGCTTAATGACCCGGTACATCTAGGGCTTATTATGGTGAGCCAACCACTGTGGTAGGTT
GGTTTTCTAACGACGATAAATGCCTTTGTCTGCCCCCCATAGGCTCTCCAGTCCCAGGTTGCGGATACGAAGGCTGTCGAGGACGTCAAGAGCCTCGAGA
CGTTTTTCAGCATGCTGCACACGGACCAGGACCGCGCGTACTACAGCTACAAACATGTGGTGGCGGCGAACGCGAACAACGCGATTGAGACGCTGTTGAT
CACGGACGAGCTCTTCCGCAGCCAGGACATCGCCACACGCCGAAAGTACGTGGACCTGGTGGAGAGCGTGCGCGCGAACGGCGGCACCGTCCGCCTGTTC
AGCAGTCTGCACGTCTCGGGCGAGAAGCTGAGCCAGATCAGCGGCGTGGCGGCGATTCTGCGGTTCCCGATGCCCGAGATCGACGAGGCGGACGACGGCT
CCGACAGCGACTCGGATGAGGCCGAACAGGAGGACGAGCTCAAGGAGGAGAACGTGTACGAGGACCTGTCGATGGACCCGCTATCCATGTAGACGTACAG
GTAGTGAAGGTGAACGTGAAATACACATAGGAAGACGACAAAGAAAGCATCCATCACTACTATAAGAAAAAAGAGCTATGGTTACGCATTCGCTGTGTTA
TGCGCCAGCACGAGGTTGTACACTTTCTTCTCAAAGTTCTGCGACGTGATGCGCTCGCCGATCGGCGCGAACGGGTTCGACATGGCGTTCACGTACATCT
TGTGCAGCTCCGCGAAGAACTGCCATCGCACAGAGGACACAGCACTGTTAGTTCATGCTTCTTCCAGCCACTCGTTTATTAAGCTATACGAAGGCAACAA
CACTGTGCGCACCGATCGGAGTTCCGACTCGCGCACGGGCGAGTCCTGCATGATCGCCACGAACTTGACGGACGTGTTGGTGACGTAGCCGTATCTGTAT
AGACAGAAAGACACACGTGAGGACGATTCACAAGAACAAGGGCCAACCTTAGTCCACAAAAGAGCCTCACGCGCGGTAGTCTTCGATGGGGCCGAGGAAG
CCGAGGTACATGTCATCCTTCGCGATCATTGTGCCGGCGCTGCGCAGCTTCTCTTCGATGATATCGAGCGACACGTGCGCGATGTAGTGGAAGCCCAGAT
CTTCCTCCTCATCGAACGTGCGGATGTACAGCGGACTGTTCTGTACATATAAGCAATGGTATACAGAATAGACACATACAGCGTGAACAGAGCAGCATCA
TGTTGTGTACAGGTAGATAGCATCAACAGCCAGTATGAGCACGCACCGCAGCGCCGATCACCGCCACGCACGAGATCAT