Description :
From Genome Similarity Track
Location :
Scaffold_1153:219- 2634
Sequence
2415 bases(100 bases per row)
TCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACT
TGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGT
CAGCCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCC
CGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATTCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATC
CACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGCTCCTGGCTGGCCCCGCTAGCAG
ATCCGCAAAGGACAAACACTTCTCATCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGA
TCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGGGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTG
CTGACGAAATGGATGGGCCATCCAGATCATCTAGGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTC
GTGGAGCACTTGCACTTGTGGCACGGGCGCTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCGGTAGGGTGCCCGAGGAA
GTGTCGGAAGAACCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGCGGCAATTACCTTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTTC
CGGATCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGAGTCTTCGCGTTCAGAAGGCCTTCCTGTCCCCGGATCCT
CGCCCGCGCTTCCAGCATGGATACCCGGAGGGTTTTAAATTTATGCGTCGGGGCTCGGACGACGTGTCTGACCCATCCTCAGCCGCGGATTCGTAGTTCG
AGGACGCAGCTTGGCTGATCCTTGGTGACGACACTGGATCCATAGCGCGCGACCTTTCTCCGGTGATGGACTTGACTCTGACAAAGAGGCCCCGCGTCGC
GGACACTATGAGATCCAATTCTAGCTCGAATATATCCTTTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATCGATCTTTGACT
GCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCACTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGAAGTCGCGTAA
AGCTTGGTGGCGATACAAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACCCTGGAGCTTGCATCTTCTTCCGCG
TAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGAGGTTGGGTTTTGGTACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCG
TTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACGCAAGTCAAGATCCACAGGGGTCGTTGAGGGGACCTGGGAGGATAGAGAGGTTTCTCTT
CTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGA
TTCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACG
CGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGA
TGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTG
AGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTA
TGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTG
TGACGGGATCTTGAG