Description :
From Genome Similarity Track
Location :
Scaffold_2860:219- 1878
Sequence
1659 bases(100 bases per row)
GTACCTCCAAGTCTGAGGTCTTTTACGCTTAGACATTCGCCTGACGAGCTCAAACCTGTGGCCTTAAGCGGCGAAAAGTTTGTATCGGTCCCGGCGTTTG
AAGCTGTTATGTCCTGGAGGTTAGATCTCGTCTATCCTGGTGGCTTTTCATCGCTGGGAGCAGAGATTTTGTGTCTTTCGGATGAATGTGGTGCAGAAAT
CGATGAGCAGCCTGATGCCAGAGGTTAAAGTAGTGGACGGACCGACATGGACGAGATATAGAACTAGGAGCGACTTGGAGAAGTTGCGCGTGGGGATTGA
ACCGGATTGGACTGCAGCAATGCTTTGGAAAACGCCGCGTGTTGGGCCAGCGACTTCCAAGCCGATGTTTTTGTCGCCTATTCTTTCGTCTACTTCTCGC
TTGACTGCTTCACCTGTTACACCAACGCCGTTAGCGACCATCACGCCGTCAACATCATCGGGAATCATTTCCAAGCTAACGTTTATCGCATCAGGTGCCG
ACAGACTTCCGTTGCTGTGTATAATGGATAAAGATGCTGGTACTCTTCTGATGAAACCCATTTCACAGCAACAAAGCGTTACTCCAGTGCCTGACCAAGG
TGGCAATGAAAGTGATAACGTTCATATCATGTACTGTCGTGACGCGGCTCCAGTCCGGCACGTAAAATCGTGTGAAGTTGGTGAAAAGCAACATGTTGAC
AGCCCCACAGACATTGTGGTGCTAGAAAAAGATGGCTCGCTTGTGCTGTATAGAGCGCAAACTCTAATTTGCCGCTTGGCTCTTCCTGATGTGGAACAGA
ACGGCTTGGTTGCCAACGTGCAGTTAAACTCTGTTGACAAGGGCGACGCCTATGAAATCGTGTACCCAGATCTGTGTGGTAGCTGCAGTGGGAAGATCTG
GCGATGCGAACATCCATTAAAGATCGTGAGCTCTCCGCTGTTACAGCAAGTGTTTGATGTGCTGGACTACGTTGTTCCCTCGACGGAGCTAGATGTGTTT
AAGGCACACGTGATTTGCAGGGCACAGCAAAAAGCTCGGGACTTTGCACGAGATGACGACTTGGTGGATGGTGGGCTGGAATGGCAGGCCTTCTGTGAGA
GTATCGCTGGTATGTTGCCGGAGCAAACAGATGATAAAGATGAAGTGCTGTCATCAGTAGCACTGGGGACGACTGAGGATGATGTGGAGATGGCTGCTGC
TTCAAAGTCGTCATCGTTTGATTTGCTTTGCCAGAGTGAATATCACGACATGTATCAGTATGAACATGCGATGCTTTTTGCCACAATGGAGCTCCCCGCC
ACGAATGTTAGTCCTCGTGACAACCGTGCCACTAGTCTGGAAGGCACACAAAGGGGGGAGAAGATACCACTTATTGAAGACCATGCGGGGATCATTTTTG
CAGGGCTTCACTTGCTTTGTGAAGATTTAAAACTGTCAATAACGCTCTATAAGGAGCGTTTGCTTCTAGCAGAGTTGGTATTCAAGATGTCTCTGCGACT
GAAGCTCAAGCCTTTTGTCACTTATTACACGGAAGACAATTGCGTTCTGCAACACCGAACAATACTACGCTCGGAGTTGGAACAACCTCCAAAGAGCAAC
GAAGGAGGATTGCTTGGCTTTACGCAGTATGGATCTGTGCCAGATTTGCTCTCGTGGCT