Description :
From Genome Similarity Track
Location :
Scaffold_2099:2189- 4991
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2099-snap-gene-0.3Animal inward rectifier K channel (IRK-C) family protein

Sequence
2802 bases(100 bases per row)
CGCCATGCCGGCCAGCAAGAAACGCATCCAGCGCGGCGCCGGCGCCGGCGTCATGCCGTCGCAGCACGTGCCGGCGGCGCTGCGCGACTGGGTCCACATC
TGGCACGGCGTCCAGGTGCGGCCGCGCGCGGCGCTGGCGCTGGCGGGCGCGTCCTCGGTCTTCCACTCGGGCTCGCGCATGGAGCGGCTGTCGTTCTGGC
AGCAGCTCATCCGGCTTCCGTCCAACTCGCTCTTTAGCACGTCGCTCCACACGCGTGCGAACCCGCGGCGCCAGTACAAGGACTTTCTCTACGTGCTACT
CAACATGCGCTGGCCCATGCTCATCCTCGTGCTACTCGCCGTGTTCCTCTTTAATATTGTGGCGTTTGCGCTGCTCGTGTACGCGGCGTGCGGCAACCCG
AACTCGCTCCAGGGCTGCGTGAACTTGTCGTACCAGACGTTCAGCACCATTGGCTTTGGCATTGTGTACCCGAGCACGACCTGCAGTAACCTTGTCATGG
TCGTCGAGTCATTTGCGTCCATGATGGTCACGTCGGCGATCACGGGTCTCGTGTTCGCCAAGTTCGCCAAGCCCAAGGCCAAGGTCGCGTTCAGCAACGT
GTGCGTGATTCAGCCTTACGGGAAAAAGTACCTCGCACTCGTCGTGCGCGTGGCCAACGCCACGCAGTCCAAGGACGTGACCCACGATGTCATCATGGAG
TCAACGTTCAAGCTGAATCTGCTGCGCATTGAACGCAATGCCGAGGACGAGGCGAGCCACACTAGCGACAGCAGTGGGACCATGAGTATCATGGCCGCCG
CTTCCAAGCGACCAGTGCAGCGGCCCGACGTGTTGTGCTCGTACAATCTCAAGCTCGTGCAAAACAACTTCATCACGTTCCGCATGGGCATCGCCGTGGT
CCACGTGATCGACATGGACAGTCCACTGTACGGGATGAACGAAGCCGACGTCGCTGGCGCCGACATGATCTTGGAGGTCTCCATGTCGGGCGTCGACTCA
ACGCTCCAAGATACCGTCTCGGAGCGATACACGTACACGGCCGACGACTTCAAGTGGGGCTTCCGCTTCGCTGAGCTGCTGGATTTCAACGAACGCAATG
CCGAAGTCATTATGGACTTTGCCAAGCTCAGTGCGATCAACCGCGCACCGATCGACGATGCGCGGTACCTGCAGTCGCCCCCCATCACAGGTTTCGGCTC
TTCCTCCGCCTCGTCGTCGAAGCGGCAGATCTCGTTCCGTGCAAACGCCAAGAGCAAGCGCCCCGACCTGTTTCCGCGATCCACTAGCTTACGGCTCGCG
GGGATCGACATCGACGCGAACATAACCAGCAGCGCCACGAGCCAGGAAAGTACATCGTCCCGCGAATCTGTTCGTGCGATCGAAGAGCTCTCCCCTGATG
ACCTTCCGGAGACGAGCTTGCGCCGACGTCGTCTGGGTAGTTACCATGCGGAAGAAGCTTCCCGTGCGTACCAGAGTACGGCATCGCCACGTCGGCCTCG
ACGCTTCAGTATGGGCATGGAGCCGCTATTCGAACCGCTGTTGCAGACGTCGGTGGGTACTCAGCGGCTCCAAAACCCGCCATCCCACGTGCCGATCGCG
CACGCCGCCGATGTGCCGCTCTTGCGGGGTGCTCGTCTCTTGTCTGCTCCTGTTGCTGACCATTCGCCCGGTCTGGCCGTTGATGAAGCTGGGCCGCCGG
GAGACTACCTGCTCCCCGAACCGCACCGCCAGCAACTACAGAATGCCTGCGCCGGCGATGTGAATCACGACGACGACGAGACTTCGACCGACGGAGACGA
AGACGAGACGAGTCCGGGACGCCAAGAAGACGACGACGACGATGCGGTTGCGCGCCGACACAAGCTGCTGCGCTCGAAATCCAACGTCGGGAACCTCTCG
GTCGTCTCGATCGACGTGCAGGACACGCCGCGATTTCTCAACATTTCGCCCATCAACATCCCCAAGTCGTACAACTTCATGCAGCTCTACAACAGCGCAC
TGTACGCGCGGTGGCCCAGGATCATCCTTGCCTTTATCATTGCGTTTGTCGTCATCAACGCCGTCTTTGGACTGCTCTACTGGGTGCATGCGTCGCAAAT
GGAGGTGTATACCGACATCTCCCTGACGAAATACGAGCTGGCGTTCTACATGAGCGTTCATACGCTCGCGACCATTGGCTACGGCTCGATCGCGCCCAGC
CCGACGTCGTCGTACATGAATTTCTGGGTGCTCGCCGAGGCGGCGCTCGGCATCATCTTTACGACCATTATCACGGGCATTGCGTGGTCTAAGTTTGCTC
GGCCGCGCGCGCATATCCATTTCTCGTCCAAGATCGTCATTACCAAGATCTACGGCCACCGCTGTCTCGTGTTTCGCGCCGCCAATACGCGCCACAGCGG
CGACGTCCACGAGAACCTCTTCCGCATTGGCGTCATCTTGACCAACCGCAAGACGGGACTGCGCCAACTCTACGACGTGCCGCTCGTGACGGCCGAGTGG
CCGTCCATCAAGCTGCCGGCCACGCTCATCCACATCATTGACGAGTCGTCGCCGTTCTACCACTTCCAGTCGGTCGACAATCTCTCCGAGTCGCGGGTCT
CGGTCATCGTGCTGCTGACGGGACTCGACACGACGTTTTCCGAAAATGTCTACGCCCGCAAAATGTACTTTTGGGACGATTTCGCCTACAACATGCGGTT
CGCCGACTTTGCCGTGCTCCAGCGCGATCGCGTCGACGTGGACTTCCAAAAGTTTGATACGCTCGAGGATGACAGCGAGTCGTACGTGGCGCCGACGCCG
CT