Description :
From Genome Similarity Track
Location :
scaffold_1281:2189- 3872
Transcript NameFunction/comments
Pl_100925hypothetical protein PHYSODRAFT_506784

Sequence
1683 bases(100 bases per row)
ATATCAACTAAAGTTGTGCATTGTTTAGCCGCCTTCTATCGTACGACTCCATACACAGGAATGTAAAACAAGTACTACAATACTACACGTAGTAAAGCAA
ACAAGCTGATACATTTAACAGCCACTGCCACCAGCAATCATCAAACACGAAGTACTGTCAAACATGGCCATGAAGTTGGTCATCAGCGACCACACAAACG
CAAATGTGAGGTAAGCCACCGTGAGTGCGCCCATAATCTTGCTACTACCACCAGTGCGCAGGAGTTCTTGCGTCTCTTCCTTCTGACGAGGAAGAAAGAA
GAGGAAGACCCATGAGAAGGCCGTCATAGCATACATGATGATCACAGCGTACGTGATGTCCGTACGGATCGACTTGTCATCTGTCTGGATACGCTCCGTG
GTAAGATCAAATGGTTGGTCAATTACCAGCGTCATTGCCGTCGCAAAAGGCGAAGACAAGTTGGAAACCATCGTAATCAGGCCGTAGACTACACCCTCAT
TACCGATGCCTGAGAGTTCCACAATGACGAAGGTGGAAATCATAAAACCAACACCGTACGGGAGCTGAACGGCAACGGGCAAACCGAGCCAGAACCACTG
GCTGCGGAAAACATCCCACACAGTGATGAAAGTGGTGATGCCATCGACAACCATGACAAACACACCGGTGAATACGATCATCAAGCGCCAGTTCCAGTGT
AATCCCCACTTGGATGTGACCATGATACCAGCCATAAACAACAAATTGCCGAAGATGTCGCTTAGGGTACTGTTAATGGGGGTGACGCCAACCATGTATG
ACTGCACAGGCGAGCTAGCAGTGTATGAGATGCTAGAGAACATACCCTGGAAGAAGTTGAAGAAGATGACCTGGTACATTGCGCGCTTCTGAATCAGCTC
CCAAATCTCCTTCATGTAGCTCTTGAAATTCACACGAGGCATCTTCTCCTCCTTGATGAAAAACCACGTCATGGGGATGACTGGCGTTGTCAAGACTGCG
AGAATGATCATGAGCTGCGGAAAGCTGATTGAGAAGTCAAAGTCGCCGCCGTATTGTTCACCATTGAAGCAAAACCCAGTAAGCAACTCACCGATGATAA
CAAATGCAGTGCGGACAGCATAGATAGCAGACTGAGTCTTACCACGAGTCTCGAGCGGTTCACGCTGTGCAAAGTCCACCACAATACTGTCGGCGCACAC
GTCTGATAACACGTAGCCTACCGCAGCAAGGAACATGAGCATGACGTATTTGCCAGCTTGAGAGGCGGCGTCAGAGTTGATACGAGCCTCGATTTCAGGC
GTATAGTCGGCAGGCTTGATATCACGGTCGGCGGATACCGTGTAGTACGGATCTCCCTCCGGCATACACGCCATAATGAGCAGCGACAAGAGACAAATGA
GCCATCCGATCACCATCCACGGACGACGACGGTATCCCCACAACGGCACGCAGTCTGATAGGATACCATAGAAACACTTGAAACTCCACGGTAGCACCAA
CAGCGTCGACGCGGTCGTCACTTGGGTACCGGAAGCATTGAGGTAGTTTTGCAAGAATGGGTAGATCGTAGCTGGTAGAACACCGTAGTTGAGACCCACA
GCAGCGTATTGCACGAGAAGACCCAAACTGTCCTTGCTCTTGAGGTCGGGAGCACCGCCTTCACGTAGAGCTCCACCTTCAAT