Description :
From Genome Similarity Track
Location :
scaffold_1255:2189- 3411
Sequence
1222 bases(100 bases per row)
AGACCAATGGAAACAAGCTCTAGAGCTAGAGTACGAAGCCTTAATCGAGAATGGGGCATGAAGACTCGTACGGCTGCCACCAGGACGAAAGATATTGCCA
AGGCATTGGGTACTTGCTATCAATTACAACGCCGACGGTACAGCGGAGCGGTTCAAAGCACGCCTCGTAGCACAGGGAACCACCAAGCATTTAGGGTAGA
CTGTGACGAGTTATACGCACCTGTGGCACGATTCGAGTCGCTACGCCTAGTGCTAGCAATCGGAACCATTATGGACTGTCATATCCAACAAATGGATGTC
CACACGGCCTTCCTAAACGGCACAATGGATGGGGAGCAGAAAAACTACATGAGGCAACCTCACGGCTTTGTGAAGCAAGCGAGGCCACGAGCATCTGGTC
TGTGAACTTCAGAAGAGCAGCTATGGCTTGAAGCAAGCCCCTCGCATTTGGCACAGAGTGCTACACTCCGTTTTGGCGGAGACGGGTTTTACACGCTGCC
ACAAAGCGTTTTGCATCTACGTGCAAGAAGTTGGAGAAAATTGGCTTATAGTCGTGGTATATGTTGATGATCTAACGATCACGTCGAGAAACATGAGACT
CATCAACACGCGAAAAGCTGAGTTGTCAAACCGGTTTAAAATGAAGGACCTTGGTGAAATTCATTACATCCTTAAGATGGAGGAGCGACGCAATAGAGAA
CAGCGCGCGATGACGATCTCACAACGCAAATACATTGCAGAACTAATCATTAAGTACAATTAAGTGGATAGCGCGCCAGTAATGACACCGCAAGTGCCTG
GCCTAACGCTAGAGCCGGAGACGAAAATGAGCGCAAAGCAGATTGCGGCGCAGCCTTACGACTACAGAAGCATTGTTAAATCACTCCAGTATTTGATTCG
AGGAACACGACCAGATATCGCTAATGCGGTGCGCGAACTTAGCAAGTTTCTGTCTTGTTACAACCGCACGCATTGCGATGCAGCTAGGCGAGTACTCAAA
TACTTGAAAGGGACGTCAAGGTACGGTCTTTTTCTCGATGGGAAAACGAAAGATGTGACTTATGAGGTGTACACGGACGCAAGCTTCGCGTGTCAACCTA
AAGAACGTAAATCGGTAACGGGGTACGTGATCCAAATGGCTAGTACCAGTATTTCCTGGCGTAGTAGCAAACAAGGAGGTGTCTCGCTTTCTACTGCTGA
AGCTGAGCTTATCGCACTAAGC