Description :
From Genome Similarity Track
Location :
Scaffold_163:21888- 30807
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.18Copper-transporting ATPase
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.22Adenylate kinase domain-containing protein 1

Sequence
8919 bases(100 bases per row)
GGGATCATGGGCGTCAATATCAGTCTGTTGACGAGTCGGGGCGTGTTTGAGTACGATCCAAAGATGGTGTCTGAGAAGGCGATCGAAGACATGGTCGTGA
GCCTCGGGTTCACTGCTGGTGTGATGCCGAACGAGTCCTTCGTGTCCATTGTGCTGCACGTCGGATACGAGCACCCAGCCAAAGTGTGCACCATGCTACT
CGAGATGCAAGGCGTTATGTCTGCGAAGGAGACCGAGGATGCCACGCTCACGACGTCGCCAAAGCTGGGAATGGGAGCGCAAACGGCGGTNNNNNNNNNN
NNNNTACGACCCAGAAGAAACAGGTGCGCGCAAGATCGTGCGCCAGCTTTCCGGTGCCGTGGGGTTCCAAGTGTACGCTTCGACGCCTCGGCCGCTTGCT
GTGCAAAACGAGGAAGCAGAGGTGAAGAAATTCAAATTGTTCCTTATGGCGAGCTTCATCCTGTCGCTGCCGATCCTGATCATGGAGTATGTGTTGCCGC
TGTTTGTGGCGGCCGAGTNNNNNNNNNNNNNNNNNNNNGCGTGATATCGTGAGCGGTCTAAGTTACAAAGACGCCATTGGCATGGTGTGCGCGACGCCGA
TTCTGTTCATCATCGCCTTCCCAATCCACGAGAGCGCATTCTTGGCGTTGCGCTACAGCTCCCGCGTGACGATGGACGTGCTCATCTCACTCAGTTCGTT
CGCGGCATACATGTTCTCCGTCGTGACTGTTTTCATGGGCATTTTCCACGTCCATCCTGAAAGGTCAGAGACTTTCTTCGAGGTGACGGCGCTGCTCATT
ACGCTTATCCTTGTAGGTCGGTACATTGAGAAGATCGTTAAAGCAAAGGCATCAAACAGTGTCGATGCGCTTCTTCGAATCCAAGCGAAAACGGCGATTC
TCCTGGAAGCGAATGGCGGAAACGACAAGTCGATGAAGGAATCGTACATTGATATTCTCCTCGTCGAGCGCGAAGACCTCTTGAAGGTGCTCCCAGGCAC
GCGCATTCCAACGGACGGTGTGGTCATTGAAGGCGCGAGTACGGTGGACGAGTCCATGGTGACGGGCGAATCGCGCAAAGTCGCGAAGGAACCGGGGTCG
AATGTGATCGGTGGCACGATGAACTCGCAGGGCGTCTTGATCATGCGCGTCACCCACACCATCACGGAGTCGATGCTGGCGCGCATTGTGAACCTTGTTG
ATGATGCACAGTCGTCCAAGTGTCGCAGCCAAAGCGTGGCTGATGTGGNNNNNNNNNNNNNNNNNNNTCACAACATTCATTATCTCGATCTCGGTCATCA
TGTTCTTTGTGTGGTACCACTTGGCGCGCAGTGGTCATGTCTCGACTCACGGATGGGAGCCGTTCCCGTTTGCGCTGCGGTTTGCGATCACGATCTTGGT
GATCAGTTGTCCGTGCGCCATCAGTCTCGCGGTGCCCACGGCGATTATGGTGTCGAGCACGATTGGCTCCCAGTTTGGTGTTCTCTTCAAGGGCGGCCAG
GCGATCGAGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACGAGCGGGAATCTCGCGGTCGTCGACGTGA
TCATTCCGACCACCAACGTGCCAGAAGAAAGCGCACGAAAACTGTGGAGTTACATTGCAGCGACGGAAAAGAACAGCGAACATGCGATCGGGAAAGCGCT
TGTATCGTACGCGCACCAACTCAATGCGCCGACTTTGTCGGTCGTCAAGTTTGATTCGATTCCTGGATGCGGCGTGCGTGGATTCCTGGATGATGGCCGT
CAAGTCAGTATCGGATCGCTCAAGTGGATGCAGGACGCGCTCAAGATCGGAGTGCCAGTGGATCTGCACATGGCGAACAGCAGATTCCAGCAACACGGCT
ACGTCGTCGTCTCGGTCGCGATCGATAACCAGTTGGCCGCTGTGATCGCGCTTCGCGACACACCACGACCGGAGGCACGACTCGTGATTGAGCAGCTGCG
ACGCAAAAAGATCCAAACGTGGATTGTCACGGGAGATCAGCGCGAGACTGCGCTCTCGGTCGCTGAGATGCTCGGTATTCCTGAATTCACTGTGATCGCC
GATGCCCTGCCGCATCAAAAGGTGGACAAGGTCCGATTGCTACAGAGCATTGGGAAGAACGTCGCGTTTGTAGGCGACGGCGTGAACGACGCCCCGGCAC
TCGCGATGGCGCACGTGGGCATCGCCGTTGGTGCTGGCACAGACGTGGCGATTGANNNNNNNNNNNNNNNNNNNNNNNNNTCTAGTGCTGGTAAAGGACG
ATCTGCGCGATCTGTTGAACGGCATCGACTTGTCGCACGCCACCAACAAACTGATTCGCTGGAACTTCATGTGGGGTTTCATGTACAACGTGCTGATGAT
GCCGCTGGCGTGCGGTGCGCTGTACCCGTACTTCGGCGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTCGGAGCTGCTCTCGTCGGTGCCGGTGAT
CCTCTTTTCGCTGCTGCTCAACTTTTGGAAGCCTCCGTACAAGAGCCATGACGACGTGGACCCAGAGCAAGCGTTCGTCGTGGTCCAAGTGGACACGTAC
AGCGCCAACGAGAAAACGCCGCTGCTTGTGCGGAAGTAAGTCAAGTCATCAGATAAGTAGGAGGGAGAAAAGCGAGGTCTGCAGCAGATTTCTATGCATC
GTTCGGTTGCTTTGTTCATGTGAATATCACGTTTATATTTCAACGAGAATTGGAAAGCAGGGTGAAAAGCGGGCTGTAGGCATTGGACTATGGGATTGCG
TACTCGAGGAAACTGCATTTCACGGCTGCAGCATTGATGGCTGAGGTCAGCGTTCCTGAGCGCCCCGTGATTTTGTCAAAGCGCTCGCTGAGTTCTCGAA
TGTCAAGGTCAGGAAGCGTGCCTGCCAAGCTTTCGGCAGTCGTCGCCGTTTCTCGCACAGCACGGACGCCTTTGATCGCTGTTCCACAGGATGCATTGCT
CGGCGTGATTGCCGCTTTCAGCAGCTCGCTCAGGCGGCAGTCAAGCTCAAACGCGTGTTTTTTTGCCTGGAACTTGGTTTTCACGTGGCTGGGGAGATTC
TTCGCGCGCGTCTTCAGGATGATCCCCAAGTAGAAGCACGCCGATGCTTCGACGCTCGCTTGTATAAACTTGGGGCGTTCGCTGCCAAGCACCAAAAGGG
CCTCATTGAGCACTGCTGAGAGCTCCTGTTCCAGCTTCCCGGGATAGTTTTTGCTCAGTGCGGTTGACAATTCGGGTGGAAGCTTGACTGGTAGTCGCTG
CGATGCATAAAGCTTGGGTTCAGCGAGAAATTTGCGTCGCATTTCCTCCGAAGCAAAGAAATACACCTTGTGCAGGTACGACGAGCGATAGAAGACTTGG
CCTTTCACGATCGCTGCCCAGTCCTTCGCGCCCGTGCCGAGCTTGAACGTCACGGGACAGTATCCTTTCATCTCGGGGAACTCGCAGTCAGCCACTGAAA
GGAGACTCAACAGCGACGCGTCAACTGGAGCTTTGGGAATCAGTGCCAGTGCGCTTTCTTCTTGGCTTGGATCGATAAACTCACTCGGACATTCGACAAA
CTGGTGTGCGTGCGCGGCACTTGCCATCCAATAGTGGATTCCTTCAAACTCTAAACAAAACTCACGAGAAGTTGCCAACGCCAAGCTATATCGCGATGAA
CTCAGTTCAACGGGGCAGAACGTCTGAAACACTGGATGCCATCGTTCACGTAGCGTATCTACGCTTCGAACGACGCCGAGGAGGCGAGCTGGTCGACCAG
CGACGACATCTTTCCGATACTGGCGCATCTTTTCGATGTGATCGTCTAGTTTCTCCTTTGCTTGAGCGAGCACGTTCCAAAACGAAGTCTCGGTCGCATT
GATCTGCCGAACATGGAAGCTGCCGAACTGCATGGACCAAAAGTCGAGCAAATCCAGTCGCTGCTTCTGCCAGGCCGAAAGCTGCTGGATGAGGTGGTCC
TGTGCAGCACTAAGCTCGGCTCGTAAACTCTGCTCGGTCTCGCTCGCATCTCGTTCACTGTTCTGGGTAGTTACAGCTTTGAACGTGGCCTGCTTCTTGT
GCTCCCATACGGTCCGGAAGTTCCCATCCAGAATGAACAACAGCCCTGGGATTATTGAGGCTCGAGCACCTTTCGATTGTTTGAGATCTTCTAGATGTGG
CACGTAGTCGTCCAGCACCCAACCGTTGAGCTGACATTCAGAAGATTGCAATCGTGTTGCAATCGCTTCGTCCACAGTGCTGGCATCTGGACTTGCCCCT
GCAGTCTGCGCAACTTGGACTTTCTGATACAGCGCAGTGCCTCCATGGCATTGAAGTACCCAATCACCTGCGGCACGTGGCGACACATACACGAGGTTGT
ATTTCGCACAAAGCTCGTTCGCAAATCTCGTTTTCCCAGCATACGGGGCACCAGTAATGCAGCATGTTGGCTGAAGTGGAGGCGCAAACGAGCACGAGCC
AACATATCTTGACGGATTGGATGCAAATAGTGCTTGAGCTTTTTGGTTGTGGGGAAAATATACACGACCCCGGTAGCGTACTGCGATCTCAAAGGCATTG
ATTGGTTTGCCTTCGACAGGGCATGATGTTCCGTGCTTCCCTACGATCACTTCTCCTGATGCAAGTGACTGGATCAATGTCTCGCGGTCAAGAAGATCGC
AACGATCAAACAGTGAATCCTTCCGAGCCATGAAGGCCTCAATTTCAGCAGCGAGTTTACTCACATTGTGCCGAAACGATCCAGAAACGTCGATCGAAGA
CGCTACCGCGATGCCGCGTGCCTGGAAGCTATCTATAGCTGCTGTTAAAGCATCTTGATCGGCAGCGTACTGCTCACGGAGTCGCTGCATTTCTTCTGCC
TCAGCATCCCCTAGATTGAACTCAGGCTCTTCTTCTTCCCCATCGATGTCTTGACTTTCACTTGCCTCGTCGTCGACTGTTCGGGTTCGTCTCAACTTTG
TCTTTCGTGGCGGTAGATTCCTTTGCCATTGGCTGAGCTGAATCTGAACTGCTTGCTCTTCAGCCAATTCTGTCGGGATGACTACGACCGGGAGCACATC
TTGCTGGAAACACACTTGAAGAAGCTCTGGAGATGGTAATCGAGAGTCATCCTCACCGAATCCGCCGAGGACTATGCATGCTGCAGAAGTCGGTGCTGAT
GCGTCCTCGATGACACCTCGGCATGCATCCATCGCACTGCAAAGCTCTTGCTTCAGCTCTTCAACGTATAAATCCGTTAACGACGTTTGGTTTTCTTCTG
CTTTGAGCGACTCCACCCGAAGTCGATTTGCCAGAGATTGGTTGATTTGCTTCAGATCTATGTCGAGTACCTTGGTGCTCTTGTTGATCCTGGTTTGCAA
GCTGCTTGCTAGTTGTGGGAGTCCAGCGCCTCGAACTCCAAGCATAACAATGATCGGAATCAGAGATGATGTCGCAGCAGACGCCGTCGGGACGTACTTC
TTTGGATTCCGCTCAAAGGTACTCTGCTCCACCTTGCTAGCGAATGAGTAGTATCTCATATCGAAAGCTGTGACGAACTCTGGGTTGCCAGGAATCAGGA
TATGTTTCTCCTTCCACGTAACGGGGCAAAAACGGCCGGTCTCGCCTTGCTCAGCCCTGAGTTGGATCGGTTCTTCTGAGGTTTCTCCATCTTCCAGCGC
TGCAGGAGGAGCAAACACGGTTGCTGCATCTTCGGCTCTCAAGTAGCCATCATTGACTCGATCAATCCTAGGAGCTAGAGGGTCGAGTTCTCGTCGCAAC
GTCTCTATTGTATCAGCAGTGTCGCCAGACAGTGTACTCACCCTAACAGCCATCCCCACCTCTTTCATCATCTCTGTAGCTGAGGCAAAGGATGCTTGCA
GCTCTTGATGCTTCAAATGCACAATTCCACCCAGACCAGTGTCCTTTGCTACTTTCTCAAGCATATCTTGGCTTGGGTCAACGAAAACGATAGCCTCTGG
AAGACACTCGCGCTCTTTCAATACTGCAATGACTTCGTTTGAAAACACCAAGTTGCTGATCATCCACTTCCTTTTACCAGCACTCGAGACTTCGTGGTGA
TGGATTGCGTCTGTCAGCAGCTCTGCAGCCTGAGTTGCGGAAAGCGTCTTGCCTCCCATCATCTCCATTTCCACAGAAATTGGGGTGCGCTTTGCAAGGA
GGTCGATTGCATCGATCACTGTCAGTCCAAAGCGATCTTCAATGGCAGGATGGTATGACGCTAGCGAAATGCTGCTCACTAGCCATATTCGATTAAAAGG
CTTTGCTTGTGGTTTTCTGCGAAGATACTGCAGCGGCCGAGAGATGAACGCATCTCGTGCCTCTTGAGTTGCCGCTAAGTAAACCCGCCCTGAAAACAAT
GCAGCAAAAGACGGATTCCCCAGCACAAGGCCGCTCTCTGGAGTTGATGTTACAGGGCAGAATTCTTTCCACCTCGATAGTTGTCGTCTGTCAATCTTTG
GCGGGAGCTGCGAGAAAATGTCGTCGCCACTCGTTTGAATGCCACCATCTTCTGCAGATGTGTTCAATACGCTCCAGTCGCCGTGCAAAAGCCATCGGAT
CTGCTCAACACGATCGGTCGATGTGATATCACCGGGAAGTGGCACCGGAATCGCTCGCCTTGAAACGTTTGTCCTTGAAATGCCCATCGAATTCTACACA
TAAAGCAACATCGTCAAAATACAATTAGTTGCTTTCTCCACAACCCCAAGCCGCGCGCTGCAAACTTACTGCAGTCATTGTCCGAATGCAATGGTCTATA
ATGGTACATAGAGATTGCGACGCCAGAACGTGGATGAGGTGGTATCTTTGCTTCGGAGTATTCGGAAGATCATTCGCCAACGCCTCCAGACGCGTTTGAA
CGCGGACCTTGTAATCCTTATACCGATCTGGAAAAGATTCTAAGAGAAGAGTGCGTACTGGTAGCGTTGGTTCGCCGGGGTCTTCAACTTCGTTTCTCTC
AATTTGTGATAGCTCTGGGGGAGGTGTGGTCTCAACTTGCTCCCCATCAGCATCAGCAACTTCCTCGCGCTCTTGTTCTGTTTCTTGTTCTGTTTCTTGA
CCATTAGATATGTCGGCTTCTAGCTTGATTTCGTCCTTCTTAGAGTTGATGTCGGATCCATCGTCTGCTGCAGACTTATCCTGTCGTCGAACAGAATCGG
CAAAGCCTAGCGCTTCGACGCTGATGGAGTCTCCAGCCAGAATCGCTCGCTCCCGTGTGGAGTACAATCGTCTTGCAGATGGTGCGAGAGTAAACTGCTG
CATTTGCATCTGAATATCGTCTCGGGGTGCAGACAAAACTACCAAATAATCTGTTCCAATCTCCGTTTCGATCTCTCCAGGGTGAATATCATCCATCACC
ACACCAACGCCCTCTGTGCACGGTTACAGTAAAGCAATGTTAACCATCGGTTTGCAACTGAATACGGAGAATGACACTCACCTAAAAGCGACTTCTTAAC
GTAATACGTGAAGATCTCCAAGCATTTGGTCCGGGAGAGCGCGCTTCCCGAAAAAAGAGTGTCCAGGTCAGCATCGGAGAATAATAGATCCTCTTCATGA
ATCGGCTCTGGGACCTTGGTCGCTTCTACCATAACTGGTGATTCAGCTACCAGTTCGATATTGTCGCCGACTTCTCCACTTCTCTGCTCTGATTCAGTCG
GCTCGCTCTCTTCACTTGATTGAGTTGTGGCAGTGTCGTTAGGTGCAACGGGCTCTTCATCTCCTTTAACCTTGCTTGATAGAGCAGCAGCTCGGAGTGC
AGCTCGAGCGTTTTTCCGCTGAATAGCTTCCTCAAGCGCTGTCCCTATGGAGACATATCGTAGTTTCAGTTTTCTTGCAAGCATCTTTGAGACGCGTGTC
TTGCCAGCGTGCGGTGGGCCAACCACTGCTACTCGAAACGCTGGAAACTCTTCAAGCGACTTGATCGTCGCTATCTCTGCATCCCAATCGTCCTCGCTCT
CTTTATTGAGTATCCGAGACGAAGTTGGCGCTGACGCTGCAACAAGAGCTGCTTTGCACGCATGGTCAGGGTCACTTTCATGCGTTTGCATGCGTGGGTC
GGTTGCTTCGTCGAAATCCTCACTTTGCTGGTTGTTTTTGCCTCCATTTCCTCTAAATAGCGCTGAAAACTTGCGTGAAAGTGCAAATTTACGCGGATTG
TAGCACAGCAAGAGCTGCTTCAGCGACATTTGCTGCGAGTTTGGTGGCGCCAGCCCACTGACGGTCTTGAGCTGATCGAGACCTGGAGGCATCTTCTGGA
CGAAAGCTCCGCGGATCTTGGCGACATCTCTCAACGGACGGAGCACATAGGATACTGCTTCGTATAGCTGCGACGAGGACAGTGAGCTTTTCAGCGTCAA
GTCAATTGTTGGTTCCTCGGACGCTGGACCACTATCACTGCGGGCGATCTCAGAATCACTCTTGCTTGCCAGTAAACCACTGATGTGGCCATCAACCATC
GCAACGCTCTCTCGAAGCTCCAAGAAAAACGACACGTACATCGAGTGCTCACTTTCAACTGGGAGAATGAGCTCTGCGACTTGCATAAGCGCTTCGCGGA
AAAGCTCCAGTGTCATCACATCGTGCGCTTCGGAGTCGTACACCCAATCGCGTGGAGCCACTACAGGTGCTCCTTCCGTGTTGATTGATTGCACCAGCGA
CTTTGCAACTCGCGCGAAGAACTCGTTGTAGTGTGAAGCAGAGAGCGTTGCTTGCGATTTCTCCTTCGCGAGGTCCCAAAAAAACACGAGATACCGCGCG
ACTTGTTCGTGCTGCATGATCTCATTCCGTCGATCGAGCCACAGTCGAAGCAGGTTGGACGTCCCATCGCCCACACCGTTCTCATGCTCTTCCTCATGGA
AGAGGTAGTGCCGACGCAT