Description :
From Genome Similarity Track
Location :
contig_35:218859- 221792
Transcript NameFunction/comments
g6772.t1hypothetical protein

Sequence
2933 bases(100 bases per row)
TCGGTTTGTTGCTGAGGTTGTGATCGCAGCGAGCGAGTTTCGAGTCGAGAGATTCCACTCGACTCTAACCAGTTAGATGACCAAGTCGAGCGAGCAGCGG
AAGGACAACGTGGAGATGCATATGTAAGTTAGTACAGCGGATTTTCATCTTAACCCATTATTCCCCGAAGAGCGTCCTATTGGTACGTAGCCTACAGAGT
CCGAGAGGGCTAATGCCTGAGCCGGCTATCACCCTGCAACCCTCTCCACCTCCAGATAGGCACATGGTGACACTAGGAAACGTTTCTGCTTACGTCTTGT
ATAGAAGCAAACTTGGACGGTGCTCAGCCTCGTCATGCAGGTCGCGTGACGTGACATCCGTTGAGTAGCTCTCGAGCCGACGCAGCATTCTCCTCGAGCC
TTACATCCGCGCTGGGAGGTCCGCCAAGCATAGCATTTTTGGATGTGGCGGGTAGCTCCTCAGCCGGGACTCCTTCAGCGTTCCTCTTCCTCCGCATCCT
CCTCCTCGCCTCCGCAGAGGACGGCGCTTGCGCGGCGCTAGAGCTTGGAGACTGGACGAGTGTGCTTGACGGAGCGAAGTGAAGAGTGAGAGCTTGCTGG
AGCAGTGAAGCGCTGCCAGCGAAGCTGGGTTCAGTGTTGAAGTGCGTACAGGCAGCAATGCGAGGGAGGCAAATTACGTGGATGGTGTACAATATGGCAG
TGCAGAGCTTTAGGTTAGCCTTGAGAGAACTGTACGGACAGACCTTCCCAAGTCTGGACTGGTTAGTGCTTTATACGTTCCTACACGTTGTGAAACAGAG
GAAAGTTCATCACATGAGCGTTGAAGTCCTTCATGACGTAGCACAGGTCGGGTAAATGTAGTCCACACCATAGACCTCTCATTCAGCTTCCCGCGCTTTT
TCGCCTCCCAATTGGTTCAAATTCAAAACGCCATCGATCATGTCGGCGTCGTACGCGCTGGAGCTGCACGCGCTGAAGGCGGAGCTCCAGAGCACACTGG
CGCGTCTAGGTATCGACACAGTCAGCTCTGATGATGAAACAGACGCTCGGCATCACGTAGACGCCCTGTCGGTACTGGAAATCGCCGCAGAATCGACCGA
AACGCGACCAAGGCGGCGGAATTCTGGCCGCAATCGGCCCATCACGCGCTGGAACCGCCGTCGATTGGTGCACGAGTTGGCTGCGGCATCCAGTAGGAGG
CGGCAGCTGGAGACACAATTGCATCGCGAGATGGAGAGCGACAGGCAGCAGCAACAGGTCAGCGACGAACAGAGCAGACGCCAAAGCGCGTGGCAGGCGG
CGATCCTCGAGTTGCAGCAGCAACGCGCCGAGATTCAGAGGCAAATGGAGGCAGAGACAGCAGAGGAGATGCATCAGACAGCGGAGAGGGAGCGGGAAGA
GCAGGTTTCTGGTGCTGAGGACCAGAGTGAGAGAGTGACTGACAGACGACCGACGGTGGAGTCTGTATCAGAGACCCACTACTCGATTGGCGGTGTGGTG
ACGTTGGAGCCTTTGGCTTCATTTCAGCAGGTGCCAGGGCTGGCAAGCTCGAGAAGTGGGGTTTCGATGCGACCGACCGTTGTTACTGCGGCAGCTGTGT
CGCCAACGGAAGCTTCAGTATCAGCACCAGCGATGGTGTCGGTGTTGGATGCTTATCCTCGCTACAGGAACACGCCGGACGCATTGAGTGACGTGTTTTC
GCTGCAGCTGAAGTTTGCGGAGACGATGCTCAAGCTTGAGAAGTCGGTGCAGATGCGTGATCGGCTGCTGCATCATGGTGGAGCCTTGCCAAGCATCGTA
CAGCTGCATACAATACTCGACAAGAGAGCCATGCACGTCGTCGTCATGGTCACCAGTCTGTACATCGCAGAGCATCATTTGAAGGCAATTCCAACAGCGA
CTCTAGCGTCATGTATAGAGAAACGCATCGTAGTGAATCGTACAGCTCCAGCGTGTATTCGCCTTCGTCACTGGATTCAACGCCGCGACGTGGCGAGACC
ATTCGAGTGAGGTACCCGAACTTCGGAGTATCAAGAGCAACCACGGCTGAAACACTTGCACCTTCCTCGTCGTGCGCAATTCATTCGCCTAGCTTGGACA
CGACAGGTGGAGGTGCGCCTGCATCCTCCACGACAACTTTATCACCTCAAGAATCGCCAAGCGCACAAGATGCTGCTGCGCAAGGGAGCGACGCGCAAGG
CGAGCTTTCCGAAGCCCGGGACGAAGAGATTCACAGGACACCCACCACCGGTAGTAGTGTGACTACCCCGACGACTGGGAGTGATCAGAAGTCCAATGCG
TCATCGAAACAGGTTCGCTTTGGAGATGATGCGTATTCGACTCCAGTGCTTGCCCGTAAGTTCAATTTCGACAACCCGTCGATCGATGAAGATGATTTCG
AGGAGAAGACGGAAGACGAGGAGAGCATCCCGAGCTTCCTCGGTGGATCTACCGTTACCAGTGTCGAGCTCAATGACGCTTCATTTCTTCGAGCTTTCCA
GCGCTTCCGTCGCGAGTTGAAGGTATCAGAGCACGACTCTTGCCTGCAATCACCGGTGCTAGCGAGGAAGCTTTTCCCAGCATCAAATATGGACTTTCCT
TCCTTAAATTCTGATGATGAAGGCGCGAAAATTGATTTATCGATCTCTGATGGAGCGACAGGCGACAACTTTGCTCAATCTGCCAGCGCTCCTGTTGAGG
AGCACGATCAAACAGCAAGGTTTCCTGGTCTCAGCGGTTTGAGTGTAGAAGAGTTACAGGAGCGTCGGAGGCAACTCTGCCTTGACATCCAGGCGGCAAG
TGCCCAACTTGTGCTAAACTTTGGGGCGATGCAAAGCGTAGCTACTGGGTCTCAAGGTGCAGACCTCACGAAGGACTGTTTGCTTGCATTACGAGATGAG
CTCAAGGCCGTCGACTCACAGATTAGGGAATTG