Description :
From Genome Similarity Track
Location :
contig_112:21881- 25608
Transcript NameFunction/comments
g13756.t1hypothetical protein
g13757.t1hypothetical protein

Sequence
3727 bases(100 bases per row)
GCAGCTCGCTCGCCGGCCAGCTGCGCGCTCGACGTCTTCTGCGCCACCATGCTAGCGTCCACCTGCCGACGCCGATGACATGACGAGCGACAGTTGGCAA
GCGTTCCGTCAGGTTGTTGTCGCCACGTTGGACAGGGTGAGAGGAGCCATATCGACCACCACAGCCGTCAATCACGAGCTGTGTGCAACGCCTGGCCGTG
AGTCAACGGCGAAAGCGTTGATCCTTTCGCTCCTGATGTCGTGGCGTCCGTCAACAGCACTTCCCAGCCCGGCACTGCACGGACAGGTGGCGCGCGCATA
CCAGCGTGGCGAGACGAGCTCAAGTATTTCGTTGTCGGACGACCGGACGAAGTGGAGTCGCTCCTTTATGCCGCCTTCACTGCTCTTCCTCATGTCACTC
CAGTCACGTCAGCGTGCACTTTCGAAAACCACGCGAGAGCAGCAAGACCGACAGTTAGTCACTCGCCACGCATTCACGAACAGCTCCAGGACCATGCAGC
CGTGGTCTCCACCCGAGAACGCGATCGTGCTGACGGATCTACTCCGGCCGTCGCCTCCTCAACACCATCAGCAGTACCAGCCGCAGCAGCAGAGATATGA
CTGCGTGAAGCAGGAGCCTCAGCTCGTACCTTCTCGACCAAGAATCGTGGAGCTCCCACCGCTCCTCCCTCCTCGAGCCCCGATGCTGCCAGCCTTCTCG
GACGTGCTACGCACGACGAGTCCGCAGCACTTCCAGCATGAGAACCAGGAGACTGCGGCGTCCGTGCACCTCTACGGGGTTGTCATCGACAAAAGCAGCT
ACACGACCTCAACTGCCGTCGTCACAGAGCAATACCCAACGACGTTCTCTGCTACATTCATGAGTACGCCCGTCTGTTGTAGTGCTCCTCTAGCGCTTTC
TCGTCGTCTAACACCGTGTTATTTGCTCCGCAGCGCGACCACATGCTGCAGACTACCACAAGAGCAGTGGACTTGTGCTTCCAAGTCTCCCAGCGACGAC
AAGCGCCTACGCCATTACCAGTGGGGACATGACGCCGCCAGGACTCGTAGGAGCACGAACTCGACCCATCGAAAACGTCCCACCCAGCCCGACGTCGCGG
CCAGCAAACCGCACGTGCAGATTCGCTGGCTGCACCCACTACGTAGTCGACCACGGTCTTTGCGTTCGCCACGGGGTACGTAGCTGATTCCTCCTCGCAC
GGTCTAGCACCACACGCTGACGTCGTTCCTCACATGCCTCCTACAACAGGGTGGGAAGCGCTGCACTGCGGAGGGCTGCACGGCTCGTGCCAAGCACTTT
GGTCGCTGTTGGCGACATGGTACGATGGTCATTTTTGGTTTATGGTACCTGATAGGCCCTCTAACGCCTCCACTTTCGATGCAGGCGGGTCGGTCGAGTG
CAAGGCTCCAGAGTGCTGCAACCGCGCCAAGTCACGGGGCTTCTGCTGGTCCCACGGCGGTGGTACGAAATGTAAAACGGGAGCGTGCGAGAAGATTGCG
ATCTCCAATGGCCTGTGCTGGGCCCACGGCGGAGGTAAGCACACTTGTCGCCTCTTTGCGGGCACAGGACTGGTCACTTACGCCATGAATGAATGACTTG
CAGGCAAGCGCTGCATCGTGCCAGGCTGCCGGAAGCAGGCGTACGAACGGACCTGCAACTACTGCAACAGCCACTTCCAGCAGTACCAGCTGACCGCCCT
CGAGTTGGCTCGGCATAACCCAAGCGTCTGAACAATTCACATGGTTATTTATTCGGGACAACGTCTACGTGGACCTTCCACCTGGAACCAAGCCCCACGG
AAAAACGTCGCGCTGTTCATGATCGCTGAGATCCGACGGAAAGGAGGTCTACGTAGAGGAGGGTACATGTACTGTTGAAGGAAAGGCGTCGGGATGGCTT
CGTTGAGTATTCTACGTCGAGCAAAGCAAGAACAGTCAGATCCGTTGTTTTCACGAACTTCACGACTTGTTGATGGTGTAATTTTGCTACAGTTCTGACG
AGAACTTCTGCTTCAGCAAATCAGTGCCATCGTTGTGTCGTGCGTTGCCAGCCACAATTGAGAAGCTACCGGTAGGCGTCTTCAAGTCTTTGAAGTCCCC
ACACCGCCGTGCCTCACATACAGTTGATACATCATGAGCAACGCGTTACCAGTCACTCTCGACGATCGTGCCCCGTGAAGCTCACTGTCTGTGCAGTCTG
CACATTGACACTGGATCACGTCTAAGCATGCATTTTTCACTCAACCAATCATATAGCTCAGCGTGTCGGATAAATACTCTCATTGGTCAGCGCGCAAACA
TACGCGCGCTTATTACTCGACACGAAATAGCTCGCGTCATCAGCATCAACGGCCGGCCGATCGGTATACGACCCCAAGCAGATTAACCATGACTTTCAAA
GTCCTCGCCACTCCTCAATTCGCCTCCAACGCAAACAATCGCCAGCTTCACAATGCCCAGCTACCGTGAGCTCCAGTGCACCAAACTGACCACCAACTTC
CGCGAGGCGACGGAGATCGTGACGCACCCGGATCTGCCCACCGCCAGCGCCGGCCACATCGTGGTCAAGAACAAGTTCCTGGGCGTGAACGCCACGGACA
TCAACGTGACCAACGGCGTCTTCAACGAGAACCCGCCGCCCTTCGGCACGGGGCTAGACGCCGCCGGCACGGTGGTCGAAGTCGGCAAGGGCGTCACCCA
GGTCACGGTGGGGGACTCTGTCGTGTACGACAAGTTCGGCGCCTACGCCGAGTACGTGGAGGTGCCCATCAACTCTGTGCACAAACTGCCCGAGCTCTCA
CCGGCTGCACTACCGCTCTCGGTGTGCGGCATTTCGGCGTCCATCGCCATCAAGGAGTGCGGCGAACTGTCGACCAACGAGACGGTGTTCGTGACTGCGG
CTGCAGGCGGCGCTGGTCAATTCGTGGTGCAATTGGCCAAGATGGCGGGCAACCACGTTATTGGCACGTGCAGCAACGACGAGAAGGCGGCCCACCTGAA
GACGCTCGGCTGCGACCGCGTGATCAACTACAACAAGGAGGACATCGATAATGTGTTGAAAAAGGAGTACCCCAAGGGAATCAACATTGCCTTTGAGACC
ATCGGCGGGCAAATGTTCAAGACTGTGTTCGACAACATGGCTGTTCGTGGCCGAATCATCGTGTTCGGACACATTTCGGAGTACCGTGGCGACATACCGC
GCTCGCCGTTCACTGTTAGCGCTATGAACGAGGTACTGCTCATGAAGGCGATCACTGTGCGCGGGTTCCTGCTGCGCACGTACGCCGACATCATCCCGAC
ACACATGGCAAACCTCTTCAAGCTTATCAGAGAAGGCAAACTGCTCGCTGGTGTGGATCCGACCGAGTTCCACGGACTTGAGCAGGTCCCCGACGCCATC
GACCACATGTACGCGCACAAGAACATTGGCAAGATCGTCGTGCAGCTCCCCTAAGGGCGACGTACCAGCTGGACCTCTTTTTTAGTGAGAAAGGCAGTGA
GTGGTAGCTGAAGAGCTAATCAATGTTCGAAAGCCAAAGAGAAAACAGTTTACCAGTCTCAGCTTTTGTGAAGCTCTCTCATCACTCCGAGGAGACCATC
AGTGTTGCCTTGTTAGCCGACTTTGCTTGTCGAGAAGTAGAATGGATTGGCGTAAGAAAGAAACGTAGCAAATTCTTCTTTGTTCTCCATGACGGCGAAG
GTTGTATGCAGTCTTCAGTGTAGCAAA