Description :
From Genome Similarity Track
Location :
Scaffold_752:2188- 5575
Sequence
3387 bases(100 bases per row)
TCAGCGGAACGCATGGTGCAAACGTTGACCTGGGTGATCAAGATGTATGGGGTGGATTAAAACCAAAAAGGTTGGGACGAATATGCAGATCGATTGACTA
ATACGATTAATACTGCGCAGGACAGAGTCTGTGGGGATATGCCATTTTATTTGATCCATGGTTTGAATCCAACATCAACCTTGGAGCAACCTTACATTGG
GAAGCACCAACCCTCGTGATCGAGACCCACGATGTTGGCGATGCAACATCCAACATCAATTTCAGCGTGTATGGGCGGTAGTGAACGATCGACTCGAGAG
CGCGATCCAAGATCGAGCGCATCGACAAAATGAGGATCTCGACTCATTGGATGTAGGTTTTGGATTGCAGGTTTGGTTGTATCTGGGTCGCGTTAAGAAA
AGGTACGCTCGAAAGTTAGCTCATATGTGGCATGGACCGTATCGGGTAGCCGAAAAATGTGGAGATCACACGGTATGCTTAGAGATCGCAAACACACCTT
ACAGATTATTCCCCGTATTTTACGTTTCAAAGCTGAAACTGGTAAGGGTCTTCCCAGAACGTCCTACCACCCAAACAAATTTTTAAGAGAAGGATCGATT
CGAGTATGATAAAGCTTTGCTACCGGAGAATAGTTGGAAATGCGATCGAGACAACAATGGAATGAGGTGGATAAGATTGTTGATGTGCGATCGGGGCGGA
AGACCCGATATGGGAGATTTCACAGGCAGTATCTGATACAATGGAAAATGTATGGTGACTTCTCCAGGATTGCCGGAGCTGATCTGAACTTTAAGACCTA
GTTCCAGAAGCTCGATCGAGATTTTCTGAGTAGGAGCCGTTTCGAAGTAATGCAATCTCATGAGGAAGAGTCCGAATATTAACGGAGTCGAAAANNNNGA
TACTTGAGATGGTAGAAGGGTGTGTGTGATATGTTAGATGGGGGAAGGGTATGTTATGTGCAAGGAGGTTTCATTAGATGGTGGAAGGGTGTATATATGT
ATGCATGTGGAGGTTAGCGAGCGCATATATCGGATAGCGGCAAAGCACGCCAAAAGAAAGAAGTTATTTTTAACGGAATGGAGATGACAAGAAATCAGGA
CGGTCATCTCCATTCCGTTAAAAATAACTTCTTTCTAATCCGATCTAAATAATACGCAGGGAAGAACTTACCGGATAGGCGTGAGACCGACGATACAGGA
TGACTTGCAGGAGAAAATCGATACTGGTTGCGCCAAGGCTCGTCGGCGTTAACATCGACAGCGCTGTAGCCAGATTTGTTACATTCTTACGCTTAAACCC
AAAGCCAGAAAACCAAGACAGCACCACGTATAATCCAGTGAAATGAAGGAAGAAAGGATCCAAAAGGGTGTTTAAGTCGAAGTGGCCGTCTATCAGTTTT
TGAAGGATGAATCGAAGGATCTTTTTCCAACAAAGTCCAGATCGCCTACGTCTCTGCTTATGTTGACGACAGAATTGGGCCGGATCGGGATCGAGCTCAA
GCTGTTCTTTGGACAAGTAGACGGAGTGCGTCGACGCTCACACAGACTGCGGGGACCGCTCTTCTCAGTCCATGTACATAACAGCGAGTAGACTGAAAAC
CCAATACGGGGAAGAGATATCGGGGCGATCTTCCGAAAAGCACTCTTTCAAGGTTCTTGCGCATAAATTGCCGCGATCTGATATGAGGTTGTCAACCGAG
GGGTCACCGGAGGCGGAGCGATCTTCGGGGCTTCGAGAAATGTCGTGCGAAGCAATCAAGGTCGAGCTCCGCCACGCTTGTCAAGCCAACGCATCGCGAA
GACCATGGGGCGACTTGATCGAAAGATTGGGATACCCGATACAGATATCCAGGGATCCAGATATCCCGAGCAACCTTGACGCCAGGCAGTTGGACGTAAT
CGGCCCGCGATAACAACGGATTCATCGACGCTCGCTCCTCCTCCGGAACGCTCATCGTGCCATCGGAATCGCTAGATGCTCCCTCGAATAGTTCTACCCT
CGGCGCTTTGGCAACGCCTAGTCGGCTAACGGGGAAGTAGTCTTCTTGAGGGATGGGAGTATCCAACACGATACTGGTTGTGGGAGATCCGGGTGAGGGC
GGTGAAGATGTCGAAGGTTTGCGACGACGGCGGGCAGACGATCTCGATACTGACAGGGCAGCCAGAGCCGTGTCTTCAAAATTGGATGATCCTTTATCTT
CGCGAAAAAGTTTCACGACGGTTTATTTTTCTGTTTCTCTTGACCAGGAGGAGGCGTGGGTAGATGGGATTGTATACCGAGGGTTCCGACCTTTAGCAGC
TGCGAATCGAGTCTCCCGCTTCAGTTCAGGCGGAGGGGGAGTGGTCCAAACTCTAGTAGGTCCGGGTCGAGCCGCCCTATTCGNNNCAGACAGACGGAGT
GACGACGAAGGATCATATGATTGTTTGCGACGGGCCATTGAAAGATATGAAGTAGCTTTGCCCGCAGGAGTGGGTTTGTTAGAAGCCGATCCCGACCCTC
TCGCTGAAGAGAGTTTATCAGAAGCCCCCGATCTTCATTTTGCATGCAGATTTTGAGGCTTCCCAGTTACCAACTGCACCACGCGATCTCGCAAGCAAGT
GTAATCTTGAATTTCCTGATTGTGCTTTGAAGCCAATTTCGCCAGATCGGCAAATAGCTGATCTATAGTGGCGTCGCGATCATTCACAATGTGGTGTAAC
CAATCGCACTCGACGTGCTGAGAAGACAGGATGTTTCCACTTTGACCATATTCCACTTCAATTGCTTCAAGGCGCTCAAGAGTTCGACAGTGTTTGTTAT
GAGCACCGAGAAAAGACTTTCTGTGGCGCGAATTCTTGTCCTATGCCATGTACAGGAGATGTACAAGCCGAGTACCCGTTTCCTTCATCTACTGCCGAAT
CCTGGCGATCAAAAAGCGGTTAAAATTCTCTCCCTCCGGGTGGCGCGCTAGCGTGGCCAGGAGAAGCACCGACTTATAGCGTGCAATATCTGAAGACTGG
TCAAGGGAGTAGCCAACTCTTCCCAACATGATTCAGATAACTCGACCGCTTCCTCCTACTGAACACGCAGTTGGTCGTACTTATTTGTACAAACTTATAA
GTAAAGAGGCGGAGGTGCGTAGATCGTGAAGTTTGTGCTCCAACGGATCCGGGAGATCTGTTGGCCCAACGTGTGTTCCATGCTACGATAGCTGCCGACG
ACCTCTTGATACAGTATCATCTGCTGGTACGACGAAGCAATCGCACTGTCAACCGCCTCACGATCTACAAATAAAGGGATCCCCACGCGACTGCTCGAGA
TCAAGATCAGATCACCCAGACTGGGGACGGATTTGTTGCCGTCGGTTGTCATGGCACTCGAGATCGGGATCGCGGACGAAGAGGAGC