Description :
From Genome Similarity Track
Location :
Scaffold_1093:2188- 4742
Sequence
2554 bases(100 bases per row)
ATCTGGTCAAGGACGGAGAACCAAACGTAGAGCATAAGACATCTGTCCTGGGCCGTCGATCTTATATCGATGACATCTTGGTCACGGCCGGTTCGTGGGA
TCCGCTGTGTGAGAAGGTGGAGAAGCCGCTAGATGTCTGCGAGGAATGGAACTTGCCGATCAGCGTGGCCAAGAGCTTTTGGGGATTGAAGAAGGTCGAC
TACTTGGGACATCGAGTATCTGCGGAAGGACTGGAAGTTCACCCGAAGGATCTATCAGCATTGGCCAATCTGCCGTTTCCGACCACCCTGAGATCGATGC
AGTCATTCTTAGGCAGTCTCAACTACTACAGCAGGTTCATCGAGGACTTCGCGATCTACGCTTCAGTGCTGTACGAACTTCGTGAGGCCGACTTCTATGA
GATCACTCGGAAAGCCAAGATCGAGGTCGGCGCAGATGAAGTCGAAGCTGGTGAACGCCAAGCTGACAGTGACAAGTGGGGTCGAGCCATCACGGCATTT
ACGGTGTTGAAGGACAAGATCGTGAAGGCGCCGATCGTGAAGGCGCCGATCCTGCAGCACTTTGACCCAGATCGGGAACCAGTGGTCGTAGTGTACGCCA
GCAAGTGGGCGATCTCTGCGGCGTTGATGCAGGAGCACGATGGGGTGGACAGGCCAATCACCTTTACCAGCCGCACGCTCAAGCCGAACGAGATCAACTA
TGGAATGGTGGATAAGGAGGTTTTGGCACTGCTCCGGATGTTGGATGTCTGCTACACGCAACTGGTTACCAGATCGATCAAGGTCCTGACCCGATACTCA
ACATTGGCGTGGCTGGTGCATTCTTCCGGTTTGCAGGGACGCCTTGGCCGGTGGGCGGCGCTACTGTCGTCGTGGACATTGGAAATCGTGAAATGCACGA
AAGGAGACGATGAGATTTTGGGAGTAATAGCCGCAAGTATCACGCCCCGATAAGATGTCGATTCAATCCTAACGTCGATCTCTCCTCGGAAACGACCGCG
ACAAGCTGTCACGATGCCACCTCCTACGGTGGAGATTGATGAAGAACTGTTGGTGGTTAGCTTTGATGGATCGGCTCGTGTAAAGCGAAGTGGGGGGCTT
ACAGCGCGATTGTGTGGGGCTTGCCCGACTGGAAGGTAATCTCCGCCGCATCTGAGTACAAGATCGATCTAACGGTGAATGAGGCGGAGTACCATGGATT
GCTCCTCTGTTTCGATCTTCTAGCAAACCTGGGCAGGGGGCGGCGCCTAATTATCTGTGGCGACGCCAACTTGGTGATCCGTCAGATGCGTGGAGAGATC
GAGTGCAAGGCTCCGAGGTTGGTACTACTACGTCAGAAGGCCATGGAACGATTGCGATCTTGGCCCAACCACGCATTTCTTCACATGAAGCGTGACTGGA
ACCAGAGTGCAGATCGACTTGCAAGCGCAGCACTGCAACGGGAAGGTGGATCAGTCGTTTCAGCAGACGGAGAACGCGAAGATCTGGGGACGCTCAACCG
ACTCGACGAATTATTGGTTCCTCGATCTGACGCGGCGGTGATCAAGATCGCGGCGGTTACGAGATCGAGGAGACGAGCAGCCCCACAAGTGTTGGATGAG
TTGATGGTACAACGAATGCGGACGGAGCGCATCTGCCAGGCGCAGGATGAAGAGAAGTGGATTGCCGATCTCAAGAAGTATCTACGTGGGGACGTGCAGG
ACCTTACCTCGGCGGAAACTAAAGCGTGTGCCAAGATTGTCGATGACTACGAGGTCGACGAAGCTGGATTGCTGTTCTACTGCCCGCCATCGAAGCGCTC
TGATGAAGGTCGTGATCTTGTGATGACCCACCGCTAGAGGAAGCGGCAAGCAAGGAAAGGAAAGGAAGGTCACACACCGACCACAAGGCAACCCCAGGCC
AAGATCACACCTGTCGATCTAGACAACCCCAGACCGAAACCGCCACAACTACTCCGGCACAGCGTGAAGCATATCCGCGTTGCTGCCACAAGTTCCCGCT
GTCCACCAGACAGTCCAAGACTCAACCCCAAGCGCGTCTTCTCGAGATCACCCGAAGAGCGATCCAGCCCACCGACGGGTACACAAGGTGAGGATCAGCA
ACTTCACGGGAGATCGGAGTACCCCCTCCGTTAGTCGGCAGTTCGGGCGCCGTGTGCAAGAGGACCCCCGCGATCTGCAAATTTCGCGGATCCACTTCGC
CACATAGGGATTTGTGACGAAGCGCCCGTGCTCTTTTCTCAGGTTACTAGACCGCTCGACCTTGGCCCTCGCTCAGCCCTGCACCACTTGGCTCAGCCCT
GCTTAGCGCTGCAAGAGCTCCTTCCACTGAGCGAGCACTCCCACCCACTTCGCTGGAGTTAGCCGCTTGAACGCTTGGCTCAGCTCCGACTCGGGTCGGG
CGAGGCGTGTGTTCCTCACTCTGGGATCCCCTTGGCGGTTCTTTTGATCACGGCTACGCTGTGGGCCCAGACTTGCGTCGGCCACACAAGCTGCTGTCGA
TGTTGAAGGTCTCCGGAGGTGTTCCCAGACGAAACTTGCTCTCCACTTGGCAAG