Description :
From Genome Similarity Track
Location :
Scaffold_47:21878- 26698
Transcript NameFunction/comments
Phyag_g1156hypothetical protein PHYSODRAFT_261139
Phyag_g1157conserved hypothetical protein
Phyag_g1158hypothetical protein PHYSODRAFT_472228

Sequence
4820 bases(100 bases per row)
CGAAGCCCTCGAGCTCCTGGCTCTTTCGTCGAGCGCATTCAATCACCGATGCAGGGAACCCGGCCATTGAGGCTACGTGAACGCCAAAGCTCTCCATGCA
TGGGCCATCGCGTACTTGGTACACCATTGTGATCTCCCTGTCGCCGGCCACGGCCGTGACATGCTTGTTTGCGAAGCCGTGCGGGTGTTCCTGCTCCAGG
GCTGTCAACTCGTGGAAGTGCGTTGCAAAAAGGCACATCGAGCGCGCCTTGGTGAGGAGATACTCAGAGATGGCCCAAGCCAGACCAAACCCATCGTACG
TGGAGGTTCCTCGACCCAGCTCGTCAATAATCACAAGCGAGCGTTCTGTAGCCTTGTGAAGGATGGCCGATGCCTCCAGCATTTCAAGCATAAATGTAGA
TACGCCTCGCTGTTGTAGATCGCCAGCACCCACTcgaaccagcagcttgtcgaacacgGGCAATCGAGCGACTTCAGCCGGCACAAAGCTACCGATTTGT
GCCATTACCGCAATTGTTCCCAGCTGACGAATGTAGGTACTCTTACCGCCCATGTTTGGCCCAGTCACGAGCTGGAAGCGTGACTTCTCGCGATCGAAGT
TGTAGTCATTGGGAATGAAGTCTACTCCGTCTTGCAATTCGACACATGGGTGGCGTGCGCTGGTAAGCACAACACAGTCACCATCTTGCACGAGTGTAGG
ACGGCAGTAGCCTGATCCAGCGTGACACGCCGCGTGCGCGAAGCCAAGCAGTACATCCAATTCTGCTAGCGTAGCAGtcgcagcttcgagcacaGGCACG
TACGTGCTGGCCACATCGATCGCTGCAGTCAACAAATGGGCCTGCCGCTCCTCGTATTCACCGCGCACACGGCGGTAATCTGCGGCAAGCGCCTTCAGCT
TTGTCGTCGTGAATTGCACGCCGCTAACCAGTACCTGGCAGATGTGCACGTACGGCAGTTTGGACAGGCGTGCTTCCTCCTTCTTATTCACAACACGGAA
AGCAAAACCGCGAACCTTGTCCTTCTCGCACTTGATTTCACCGCCGATCGTATCAAGCGCGTTGCGGTGCTCATCTTCAATATCCGCGAGGATGCCATCC
CATTCCTCTCGCAACGCCTGGAGATTTTCATCATGCTTGGCGTTCACCACAAGAGTTGGCCGGCTATCCAGGTCAACAACCTCCTTAACCAGTTCTGTAT
AACCTTGCAAATctgccagcaccttctccaatggagcagcaaacttctccttcaccagcttcgcaagcgcttcatcacCGCCAGCCTCCGTGCCCTTCAA
GAGCTTCAGAACTCGTGGCATggcaccaacagcagcgtcgtaCACACCCACTAGGTCCGTAATCTTGGCatgcttcttcttttccaGACTGACCGCCAGT
CTTCCCAAATCTGGCAAACTCTTCATACattcgtccagcagctccatcctcaACGACGAGTCGTCCACAAAGAGCTGCACGAGACTTTGTCTAGTCTCAA
TCAGCTTGACATCCAGCAGAGGCTGGCGGATCCAGCGTTCCAGCAGTCGTCGTCCCATTGGCGTCTTGCCTCGGTTCAAAATCTCCAGCACACTCCCTCC
AAACCTCGCCACTCCATTCGTCGCTGCACTCGGCTCCGGCAGCAAGTTCAGTgaccaaacagcagcactaTCCAACTGCATAGCCGACGAGAGGTTTCCC
TCGCTCAGCGTGTAGCAGCCAAAGGCGTCAGCGTCCGTCATGACGCCCAGTGCTTCGATTAAGCAAGCTAAAGAGCCCGCCGCTAGCTTAGAGGCCAGGA
CGTCTTTATACTCAGCCATTGTATTGGACCCTAGTAGTCTAGACACATTGGTCTCGACGCCGCTGACGTCGAGGAacagctgcttcttcatgtagACGCG
CGCCACCTCGTGggtttgcagcagcgcgtgcagctttTTGCTGTCCCCCAcgctctgcgtctgctccagctccgccgaTAGATAGCACGTGGAGGGAGCT
AGTTGCACCAATAGCGACTCGAGGTTGGCCAATTCACTCGAGTctgagaaggagaagagcagcagttcccACTGCTTGGTGTCTTCATTGGCTTGGCCCT
TGACGCACGACGCACGCGCGCGAGGGCGACGCACCGCCACGCCCACTTGCTTCAGATGCTTCTCGTTGcggatctgcagcgccacctccgcctgCGCCTC
TTCCAGCGTCTCTACGACggagtcgtcgtcctctcGGTCGCGGTCGGCCATGATTACTGTGTTAGTATTATGGATTGGCGGGAAGATTGCAGAGTGATTG
TCAACTTCCCGCGCTTTTCTCGTGTCCGACATGAAGTGTCTCGTTGTACTGGtatacaaacatcaagttTTTTTTTGAGACGCTTCATTTTTGGTTTGAA
ATTGCAATGGCGATGGATTGGCGTGCAGAGTATGTGaaggcgacggcgctggaggaggaggacacaGTCTCTGCGTCTGCTTGTACATCGCAGCGGACGA
GCAAGACGCCGGTGGATAAAGTGCTGGCGTTTGTGGAtctgttgctgaagcaggaGGGCGGCGAGTGGTGGGCAAAGTTCCGTCGGCATCGAATGCGGAA
CTCTTCAACGAccaagagtgatggtcaggAAGTTCGtgaggaggacaagaagcagctgagAACGTTGGAGAAGCGACTGGCCGCAGTGGGGAGCGAGttg
ctggtgaagctgccggAGTTGAACGCGTCTGTGGGCCACAAGCCGCCGCGGTCCGCCAAAGTGCGcgtgttgcagctgcagcttgtgtgCCGCATGTTGC
ACTATGGAGtgttgacgaagaagaagaaagaggagaagaagcagctgaagaaggagatccGCGGACTGCTGGACcgcgtggcgctgctgcttgatgcaGC
AAACCCACCGTCGTTGGCGGATGAAGACGCGGACGAACGCTCGCCGTTCCAGGAGTTTCTGCAGCAAAAGCTGGCTCCGAGGCTGCAGATTCTGCTGCCG
GGGCTGGTGCAGTATTTGCTGAAGGCGTACGAACTGGAAGAGGGGGAAAAGATCAAGGAGCACGAGGATAAAGATGCTGGGAACGCTATGCTACCAACCG
TGAGTGACTGTGGTGCATTTGGGTGATTGAGCTTTGCTGACTCTGTTTGTTTGAACTCAATTGCAGCCTGTGGTCAAGCCAGCTCAACCTCCTACTGAGC
CTCCAACAtcttctgttgctggaaAAGGAAGCATTTTGTCGGCTCTGCGTGATGAACGACCGGCAAAGCGTGCTCGCCCCGAAGCAAGTGGGCTGTTCAA
AGAGGTCCAACTCCCGCATCAattgcagcaaaagcaagcGCAAGCACGACCTCGAAAGTCAAAGCGAGGCAATAGCAGCACAAACAAAAGCAGTAGCGCC
AACAAAGCAAGGAGCAATCAAGACAGCCTCCTTCGTGAGGCAGTCGGTGCAAAAGTGAAGACCCTTACAACAAACACTCGATTAGCATCAAGCGCTAGTC
AACCTGGTGGAACCgacttgctgcgtcgcgcCGCTACGCCATCTATCATGAAGACACCCATAGCACCTCTACTTCACAGGACAATGTCTGAGCGTTCTAA
CTTCCTTCAACCTGGCGCTGTTAAAGTtggaggaactgcagcagccagaacTCAGTCATCAGCGCCCGGCGGATGTGCATTTCGTCGGGCggcatctgct
tcatcgGTGGTAATGGGGACGCCCGATAGACCGAAGGGAATGGCTGCGCGAACTGCCAGGAGGGTTTTGGTGGAAGCATCGCCGCCACTTCGCAGGCCCa
gcggagctggagcttctgcgcctcgtcttcttcaaccgAAGTCGTTACGACCAGGTGGCAACCCTCCTCCACTTTTTCGTTGATACTGGAACGAGTGTAA
TAGACAAAATGTAGACCTGAATTGCCATCTCTAGCTTGCcacgttgccgtcgctgttATCACTATCACTGTCGCTGCCATAGGCCACTAGTCCAAGCGCC
GCTGCATTCGGTTTGTCCTTTTTCGTCTTCGGCGATTTACTTGATTCCTCcattttcaccttcttcttcgctggttCCTCTTTGGGTTTATCAGAAGACT
GTGCAATCTTGGAATCACTCTTGCTCGGTTTCTCTTTTCCAGCCTTCCGCTTGGCTCGCACCacaaccacagcagcaggcttcTTGCTTGCCGCCTTCAC
GGCATCTTTTACCGGATACTTTTgcaagtgcagcgccgtAAGAGGCATACcagctgcagaaccagcTTTTGGGGCACCACGCGCTACCACTACAAAGACA
GCCAAATACAAGACCGTTAGCTATCTATCTACCCGATTCATCAGCACAGTAGCCCATACGGAATTGGGCGAGGTCCTCTTCGTGTTGCGTTCGGCGTTTC
CGTTCGGCATCTcccttcttgctctcgaGGTCGTTAATGTATTCGAACTCCTCATCATCCAGACCTTTTGGAGGTGCTGTTACAGATACGACAACATGGT
CAACGATCGAACATAATGTGGAGAGGTAGACCCCACATACCAAAAGGgttgttcttctccttccactcGCTatccttcttctctcgaCGCTCTTGCAATT
GCTCGTACAGCGGCTTGTAGCCTGCTGCGTCCTCTGCTCGAGGGATCGGAGCCTCTGTCAcacgcttctcctccacatTGTCGCCAAAGAGCTGCACAAA
AGCAGAAGAAAATTAGCGTTAATGAGGAGATCCTAGAAATGTGAGAACAGTGTATATGCTCAGACCGCACCCCATCGGAAGATGTGAGCACGGAGGTGGA
CACGAAGCCCGCCAAAGACG