Description :
From Genome Similarity Track
Location :
Scaffold_102:21876- 25080
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_102-snap-gene-0.20Conserved gene of unknown function

Sequence
3204 bases(100 bases per row)
CGCCGCAGGCTGCGCGCCAAGGAGGAGCTGTGCCTGACGCTCCCCCGCTCCGGCAGCCGACCCAAGCGGTCGTGGTTCATGAGCCCGGGACTCATCGGCC
GCGACGGCGGCGACCACATCCTCGTGGCGACGAAGGACCCGTCGATGGACCCGGTGCACGCCGAGCTCTCGGTCGAGGGCGACGACTACCTGCTGCGCGA
CCACCACAGCGTGGGAGGGACCTTCCTCTGCCTCACGACCGTGCGCCGCCACTACCCGCAGCGCGATGGCTTCCGCCTGCGCCGCGGCGACACCTTCTAC
ATCGGACTCAACACCAAGGTCTGCGTGGAAGAGCTCGTCACCGAGCCGGTCGACGCGGCGTCGAAGCTCGAGTCGGACGCCTCGACGGACTCGGACAACA
ACTGTCCGCCGCAGCAGGAGGAAGTCGTCAAGCCGTCGAGGCCACAGCGGTCGGGTGACAGCCGCCGCTCGAGCGCGCGCAGGCCATCGGCGCTCGCGAT
CGTCGACGAGCGAGACGGCGAGGGCGAGTCGCCGCGCGTGGTCGTGGGCGGGGACGGTGAAGCTGCCAAGCCGCCGCTGCACCGCAAGGCGTCGTCGTCT
CGGCGTCGCGTGCGGTTTGTGGACACACCGCCGCTCGCGTCAGACGGCTCGGTCGTGCTCGGCAGTCGCTACCAGCGCACCAAGTCGGTTCCCCGGCCGC
GCGCGTACCCTCGACAGCGACCTGTTTCGCTCACGCTCGCCGTGTCGTCGACGCTGCCGGACGCTTCGCCGCCGGAGGTGGTGCAGATCGAGGGCAAGGA
GCTCTTGCTGATCGGCTCGGCGCCGACTTGCGACGTCTCACTGACCGCCGAGGACGTGCATCCGGTGCACGCGCGCATCGTGTTCGACGGCTTCTTCTTC
GTGCTGCAGGACCTGTCGTTCGACGACAACCCGCGCCGCAAGACGCGCGTGTTCCTCGCCAACCCAACGCGGCTCGCGAGGGGCGACACGCTGCTCTTCG
GCGACTGCGAGCTGCACGTGACGACGCCGGGCAAGGCGTTCCGCGGCCGCGACCAGGACATGAAGGAGGTGGCAGTCCGCTGCCGCGTGCTGCGCGTCTC
GAAGCGGCAGACTCGCGCGCCGGCGCGGTTCGTGACCATCGGCTACCGCCACCGCATGGCCGAGAGCTTCGTGTTCGGCAAAGGCCGCGACTGCCACGCG
CAGATGTTCACGACGGCGCTCGCGGTCGAGCAGTTCGCCGTGCAGCTCGACCACGGCACGTGCATGATGACACCCAAGGCCTCCGGCATCAACCAAGGCA
CGTACTTCCTGCTCGGCCGCGACTCGATGCCGCACGCGACCGACCGCACGCCCGACCTCGTGCGGTACTCGAGCAAGGCACTCATGCTCGCCGAGGGCTG
CGTCTTCAAGTGCGGCAACTCGGAGTTTGAGGTCGTGTACGTCAAGTCGAGCGACGGCAGCGAAGACGACAGCACGAGTCGGGCGAGGGCCAAGGCGAAC
CAGGTGAGCGACGAGGTGCTCGAGAACACTGAACTGCTGGGAAACCTCCCGTGGCTCCAGCAGATCGCGTTCGACAAGAGGTTCGTGCAGAACATCGCGC
GGCGCGGCCGTCGCCTCAACATGGAGCCCGGCGACGTGATCTACGATGAGGGTGACCCGGCGACCTTCCTGTTCATCGTGGTCGACGGCGACGTTGAGCT
GCTGTCGTTCCGCATGGACGCGGACGGCGAAGGCGACGGTCAAGACCCGAACGACCGCATTCTCATGCGACGAGCGAGTCTGGCGGCGATCATGGACGGG
AACGATCCGGACGGGAAGCTCGGCAGCGACATCATGACGGAGCAGGTGACGGCCGGCAGCTACTTTGGCGAAATCTGCCTGCAGGGTCCGGGGATGGAGT
ACACGGAGAGCGCGCGCGCCGTTGGGGATGGGTGCTGCCTGCTCGTGTTCGACAGGGAAGACCTGGCTGGGTACCTTAACCTGTACATGGACATCATCCA
GCCGCACCTGCCCGACGAGACGCAGCGCGAGGTGCTGCAGAAGCTGCGGCTCCACGTCCCGTGGCTGCAGGGACTGTCGTACCACGACCTCCGTCTGCTG
GCGTCGCGCGCCGAGCGCGTCGAGTTCGCCAAGGGCGAGCAGCTCCTCGAGGACGGGCTCTTCCGCGTGCCGTTCCGCCGCGAGGGACTGCTCATCCTCA
TGCAGGGCCGCGCCGTGCTCACACGGCGTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACACGGCGGAGCCCGAGTCAGACCAGGACG
CTTCGGCTCCAGGCACAATCGCGAGCGACGGCGGTGACGGCGAGGATACGGACGGCGGGATGAGGAACCTGGAGGAGTGGTGGCAGCCGACTGAACCGCT
GGCGCTGATCCGATCGGCGCCGTCAGTCGTCAACGCGCAGGTGAGCTACATCGAGGCGCGGACCCACGTCGAGTGCTTCCTGTTGGACGCCGAGCACATT
GCGCACCTCGCGGTGGCTCCCCCGACTCCTCAGAGTGCTGTCGACGAAGTGCTCGAGGATAACGACGTGGAGGAAGGCGAAGGCGACGGCGACCGCGTCC
GCATCAAGCCGCTGCTGCTGCGCCAGCCGACGAACCGGCGCAGCAGCTACGCGGCGATGAACCAGCGGCTGCAGAGCTCGCAGATCATCACCAAGACGCT
CCATGCGGCGGCGGGCGACGACGACGANNNNNNNNNNNNNNNCGCGGCCCACAGCACGGTCAACGTCGGCGGCGACAGTGACAACGATGACGAGGCATCG
CGCAAGTGGCGGCGGAAGAAGCGCAACAAGAACGTGCTGGAGAAGACGCTGCTCGAGGCGCAGCAGGACGACGAGCTGCCCAACGCGCTCGTGCTCTACG
TTCTCTCCGGCGCCAACCGCGGCGACGTGCATGTCGTGCGTAACGTGGCGACGCTCGGTGCGATGCGTAGCGGCGCCGACATTGAGCTCAACGACCGGTA
CGTGTCGAGCGCACACGCCGTGATCGAGCACCACGACGGCCGCTACTGGCTCTACGACGACCTGAGCGAGTGGGGCACCTTCGTGCGCCTCGAGGAGAAC
ACGCCGGTCGAGATCCACCCGGGCGACGTCTTCCTCGCCGGCGAGATCGAGTTCACGAGCCTCGGCGCCTTCCCGGAGCGCAAGAAGCCCATGAGCTGCT
GCAT