Description :
From Genome Similarity Track
Location :
Scaffold_1093:2187- 6191
Sequence
4004 bases(100 bases per row)
GATCTGGTCAAGGACGGAGAACCAAACGTAGAGCATAAGACATCTGTCCTGGGCCGTCGATCTTATATCGATGACATCTTGGTCACGGCCGGTTCGTGGG
ATCCGCTGTGTGAGAAGGTGGAGAAGCCGCTAGATGTCTGCGAGGAATGGAACTTGCCGATCAGCGTGGCCAAGAGCTTTTGGGGATTGAAGAAGGTCGA
CTACTTGGGACATCGAGTATCTGCGGAAGGACTGGAAGTTCACCCGAAGGATCTATCAGCATTGGCCAATCTGCCGTTTCCGACCACCCTGAGATCGATG
CAGTCATTCTTAGGCAGTCTCAACTACTACAGCAGGTTCATCGAGGACTTCGCGATCTACGCTTCAGTGCTGTACGAACTTCGTGAGGCCGACTTCTATG
AGATCACTCGGAAAGCCAAGATCGAGGTCGGCGCAGATGAAGTCGAAGCTGGTGAACGCCAAGCTGACAGTGACAAGTGGGGTCGAGCCATCACGGCATT
TACGGTGTTGAAGGACAAGATCGTGAAGGCGCCGATCGTGAAGGCGCCGATCCTGCAGCACTTTGACCCAGATCGGGAACCAGTGGTCGTAGTGTACGCC
AGCAAGTGGGCGATCTCTGCGGCGTTGATGCAGGAGCACGATGGGGTGGACAGGCCAATCACCTTTACCAGCCGCACGCTCAAGCCGAACGAGATCAACT
ATGGAATGGTGGATAAGGAGGTTTTGGCACTGCTCCGGATGTTGGATGTCTGCTACACGCAACTGGTTACCAGATCGATCAAGGTCCTGACCCGATACTC
AACATTGGCGTGGCTGGTGCATTCTTCCGGTTTGCAGGGACGCCTTGGCCGGTGGGCGGCGCTACTGTCGTCGTGGACATTGGAAATCGTGAAATGCACG
AAAGGAGACGATGAGATTTTGGGAGTAATAGCCGCAAGTATCACGCCCCGATAAGATGTCGATTCAATCCTAACGTCGATCTCTCCTCGGAAACGACCGC
GACAAGCTGTCACGATGCCACCTCCTACGGTGGAGATTGATGAAGAACTGTTGGTGGTTAGCTTTGATGGATCGGCTCGTGTAAAGCGAAGTGGGGGGCT
TACAGCGCGATTGTGTGGGGCTTGCCCGACTGGAAGGTAATCTCCGCCGCATCTGAGTACAAGATCGATCTAACGGTGAATGAGGCGGAGTACCATGGAT
TGCTCCTCTGTTTCGATCTTCTAGCAAACCTGGGCAGGGGGCGGCGCCTAATTATCTGTGGCGACGCCAACTTGGTGATCCGTCAGATGCGTGGAGAGAT
CGAGTGCAAGGCTCCGAGGTTGGTACTACTACGTCAGAAGGCCATGGAACGATTGCGATCTTGGCCCAACCACGCATTTCTTCACATGAAGCGTGACTGG
AACCAGAGTGCAGATCGACTTGCAAGCGCAGCACTGCAACGGGAAGGTGGATCAGTCGTTTCAGCAGACGGAGAACGCGAAGATCTGGGGACGCTCAACC
GACTCGACGAATTATTGGTTCCTCGATCTGACGCGGCGGTGATCAAGATCGCGGCGGTTACGAGATCGAGGAGACGAGCAGCCCCACAAGTGTTGGATGA
GTTGATGGTACAACGAATGCGGACGGAGCGCATCTGCCAGGCGCAGGATGAAGAGAAGTGGATTGCCGATCTCAAGAAGTATCTACGTGGGGACGTGCAG
GACCTTACCTCGGCGGAAACTAAAGCGTGTGCCAAGATTGTCGATGACTACGAGGTCGACGAAGCTGGATTGCTGTTCTACTGCCCGCCATCGAAGCGCT
CTGATGAAGGTCGTGATCTTGTGATGACCCACCGCTAGAGGAAGCGGCAAGCAAGGAAAGGAAAGGAAGGTCACACACCGACCACAAGGCAACCCCAGGC
CAAGATCACACCTGTCGATCTAGACAACCCCAGACCGAAACCGCCACAACTACTCCGGCACAGCGTGAAGCATATCCGCGTTGCTGCCACAAGTTCCCGC
TGTCCACCAGACAGTCCAAGACTCAACCCCAAGCGCGTCTTCTCGAGATCACCCGAAGAGCGATCCAGCCCACCGACGGGTACACAAGGTGAGGATCAGC
AACTTCACGGGAGATCGGAGTACCCCCTCCGTTAGTCGGCAGTTCGGGCGCCGTGTGCAAGAGGACCCCCGCGATCTGCAAATTTCGCGGATCCACTTCG
CCACATAGGGATTTGTGACGAAGCGCCCGTGCTCTTTTCTCAGGTTACTAGACCGCTCGACCTTGGCCCTCGCTCAGCCCTGCACCACTTGGCTCAGCCC
TGCTTAGCGCTGCAAGAGCTCCTTCCACTGAGCGAGCACTCCCACCCACTTCGCTGGAGTTAGCCGCTTGAACGCTTGGCTCAGCTCCGACTCGGGTCGG
GCGAGGCGTGTGTTCCTCACTCTGGGATCCCCTTGGCGGTTCTTTTGATCACGGCTACGCTGTGGGCCCAGACTTGCGTCGGCCACACAAGCTGCTGTCG
ATGTTGAAGGTCTCCGGAGGTGTTCCCAGACGAAACTTGCTCTCCACTTGGCAAGCCCCAGTCCGCACGTGTCCACAGCCCGACATGCTCCGGGTTTTCC
GTAATGAACACGACACAACACAGAATATAGCCTCCACTTCCTCTCTTTGGTTCCGGCTCATAATCACAACACCCCTTCTTTCTCGGCCGGCCTGGGTCTG
GGCCGAGTTCGCCTTTATTTCTCTGAGCCTGGGCGAGGATCGTACCAGCTTCTCCTTTCTTCTCGTCGAGTCAATCAACGACCCGGTCTGGAGTTAGTGA
CTCGGTTTGAGCCTAGATCCAAGGCACTCGCACAAACCCTGGGACTACCCGCGCACCAGGCCCACAATGAACCGATACTAATAATCAGAAAATGCACCGG
GGTACACCAATGTCCCCAAGCACACAATACAATTACCCTGCAAAACCCTCAGAATGGATCACCTTCCACCCGAAAATATGAAATACACCCTAAGATGTAC
CAGTAAGATGAAATAACTGTACTGCCGTCGCACCGAAGTACTCTGACAACGTTGATATGTTAGCTTGAATTTGTGTGAATGATCGCCAAGACACCTTCTG
GCCAAAGACCTCCACCAATTGCGTCCTTCGGGGCAAAACGAACTCTGTTTAAATGTTTACACATGCACAAACTAGGACTGGGCGCAATATCCTCCTGGGT
ACACACTGACTTGCTGCGCGAAGAGCGTCGGTTGTATACTTACCGGGCGTCCTTGCAGATCCGTCCAAAATCTTTGGTCTTGGCCAATGCGGCGGCTCCA
CGCCGGTGCGCGTCATCGTGTAGCTGCTGCAGGCTGTTGAGATCTGCTTGAAGTGTCCGCGATCTTGAGCGGTCGCACCCAATGTAGGCAGGCTCCTGGA
TGATACACCGTATGAGTGTACTCGCCGGTACCACCAACTTCGCCGTCAGTACCACGGTCTGGATTTAAGTTCAGCGACTCGTCACAAGGCACTTCAACTG
GACTCCAACAACTCCGCTCAGGCCCATGCCACTCCACTCGGCTTCTCGACTTGGGCAAAGACTTCAAACATCACATTCGAGGCTGGGCTCGGACCCCACG
TCCCTCCGCTCAGACCTTCGTCCTCGGCCAGCTTGTCGACTTGGGTGAAGACTCCATGACCACAGTAGAAGCTAGACTCGGGCTCGGCACCACCTCGCCC
GGACACCTGCTCCTTGACTCAGCTCGGCATCGTGGACGACGGCTCCATAACCACTGGGGGGGTTGGGCTCAAACTCCACCCGGCTCCGCTCAGCTTCTCG
ACTTGAGCGGGGACTCCGGCCATCACACTCGAGGCTCAGCTCAGACTCCGCGTAGCTTCTCTCAGCTTCCGGACTCAGCTCGGACTTGGGATACCCAACG
CCAGACATCTCGGGTCCCAGACAAACTTCGCTCAAGCCCAGGATCTGAGCGGCGCTCCGCCCAGACCTCGGTCTCAGCTTCCTTCGTCACACGGCTCGTG
CCCG