Description :
From Genome Similarity Track
Location :
Scaffold_30:218691- 225010
Sequence
6319 bases(100 bases per row)
ACAAGTACCGCCAGCGTTCACGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAACTGCACGAGAACGTGCAAGAGATACGGGAGTTCACGGCGTCCCTAGT
GGTAAACCCACTCAACGAACACATCAAGATGGCTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACACACTCAGCTGTTCCGGGTGCAGTCAAGCACC
CTTGAAGAGGCGTTCAAGTGGCTCTTCAAGAAGAGTACAACCATCGCCAGGCGTGTACGCCGGCCTCAGCGTGGCCTGGGGGTTCCTTGTCGGCCCCCGG
TCGAGCAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAATAGCGTGATATCCGCTGCTTCGGCTGCGGGAAGATGGGTCACTTCAAGCGC
GACAGTCCCGCGGAGAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGGAGCCAGGATCCAGGGGAACGCCGGGAGCCAGTA
GGGGCGGGGCGCCCTACTGGGGGAAGAACTAAGTCTTCGTGATGAAAGCGCGGGTGGCGCGTACCACGGGAACTTAGCCTCTGAGAGTTTTTCGCACTCT
TCGAATCGGACGTAGAGGAGCGGCGGATTGCTCGTAGTACATGAATGTGTACGGGGATACGATTCATCTCTTTTATAATCTTGAGCGAGTCTGGGGGGGT
CGAAGAAATATCCGCACGCCCGCCACAACTTATTGCTTCGTACAAGCGTACAAAGCTAGACACAAAGAATTAGAAGAGAAAAAGAAGGGGCGGCGGGGGC
GCTGCACCACAATATTGTAACATAGAGAAGGCCGGTTGCAAGTGGGTCTAGAGATGACGCTAGACACACGACTGCACGCACCTCGCAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTGCTTCGTAAGCACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGAT
CCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCA
GAAGGACGTCGACTGGCGATGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAG
ACGAATCCGTTCAGCGTCGTCTCCGATTACGCCATCGTATGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCTCGTTTCAGTCCAGGC
AGCTCAAAGCCGTCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGGAGTTTCGTGTTCACCTTCTGGGCTCTCG
GCCCTTCGTGATCTACACAGGCCACGCATCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTTGCGGAG
TACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTACGAGTTGGCCCACATCACACGGGTGA
CAACGGATCTATATGATCGGATACGCACGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCAGGAGCGAGCGCGAAGGCCGA
CTGGCTCTCGTCGCGACAGCGCTCACAGCTCCACCCATATGAGTTGAAGGATGGCCTTCTCTATAACCAAGTGGAGCCCACAGAACCTCCACGGGTGGTC
GTACCCAATGACGAGGATCTGAAGTTCGATATCCTCGCGTAGGCGCACGACGCTCCCTCCAGCGGCCACTTGGGCCGTGAGTAGACCTTTCTGGCGGTCT
CTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGCCGCCCGGTACTTTAAGACATGCAAAACATGTCAGCGGGTCAAACTCGCAGGGCACTCTTCGGC
TCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATT
TTTGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTACCGTCATTGTTACGAGCGAACGAACCGCAAGGTTGTTCGTTGATGGTGTGT
TCCGCTATCATGGTCTCCCAGAGACGATTGGCTTAGACCGAGACCCGCGGTTAGCGGCTGAAAATTTTGGAAAACGCTGTTCCCGTTACTGGGAACTCGT
CTACAGCTGTCCACTGCGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGTGGCAGCAC
CACGTACGTGGTCGACGCAGCTTCCACTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCGCGGGGCTCACGCCGTTCTACTTGAACGGCTTCCG
TCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTTTAAGTGGAGGAGAGGCTCGGAAAGCCCTTTCCTCCTCGGTCTCGGATGTG
AGACCAGTTTCGCTGCGGAAATAAGTGGAATTCTTTATGGATACCAATCTGAGCATTGCCAGCAGGGTCCGCGATGCCATGACAGCGGCCCAAGATAAAC
AAAAGGGGTACTCCGACAAACATGACAGAGGAAACTTAAGTATATTTAAGGTGGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTTGACACTGT
CAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCA
ATGAAGACGCATCCGACGTTCTATATTGGACCCAGCCCCTCGAAGCGAGGGCCGGTCACTGACGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGG
TCGGAACGGCAAGGCTACGGTCAAGACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGC
ACCATACGCGTATGTCAGGGAGTGTGCCGCAGACGGCTTCGAACGTGGCAGCAGAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCTACACCGGAC
GAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGACCTCTCGCTCCAACAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGGCCTGG
GCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCAGGCAGCCTCAGGGCTCTGTGTCGGACCCGCAG
CCGGAGCACTCGGACGAGAGTGGCGTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCTACTCTTGCTTGACCGGAATGGAGAAGTCTACT
TTCCACGTGGAGCGGATCCTCTAGGAGCAACGGCGTCACGGTAAGCGGTAGCTCCTCGTGAAGTGGAAGGGTTACGCTCACTCTGAGAACTCGTGGGAGC
CGATCGAACAAGCACTGATTGACTTCCTGAATGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCAGGCGCTTCTCAACCGAACG
GGGTACGGATGCTGACGTCACTCCGTAGCCGCGCTCATCGTGAGCCCTAGAAGCCGCGTGCTTCAGGATCTACCTTGCCAGCTCGCGCTTCCTGATCAAG
TGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATACGGGACAGCAGCTGATCTTCATGGAGTTTTCGTAACTCCGTGGGTGAGTACTTAAGAGTAT
CCCACCCATGCCCAGAACATGTCCTCACAAGAACTCCTCGTGGGACAGTTCTCGCGCATAAGACAGGGGTATCCCCAAAGAGGATAGAGACCACACCGGG
TCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGAGGGATACGGTGTGGCGCGAGAAAGCACACACCGAGCAGCCTCCATGTTGTCAACGAACAACT
GTTCTTTCTGAACAAGGGCACGTTCGTAGATCCCCCTAGAAGTGTGGCCGCCCACAAGGCCATGAGGAGCGACGAGAACCTCTAAGAAGAGGTCAGCCTC
AGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGT
AAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAGAGATAGCACCCTCCTCCTCCTCCTCTTCATCCGAGGAGTCGAAGATGCCCC
GATGGGAGTGCCGAGTCTCCTTCTTCTGGCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCACG
CGCAGGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGACCGGACTCTCAGAG
CCCACAAACGTCCTGGGAC